Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SPRR1B-small proline-rich protein 1B (cornifin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPRR1B-small proline-rich protein 1B (cornifin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPRR1B |
| Origin species: | Human |
| Product name: | SPRR1B-small proline-rich protein 1B (cornifin) Gene |
| Size: | 2ug |
| Accessions: | BC056240 |
| Gene id: | 6699 |
| Gene description: | small proline-rich protein 1B (cornifin) |
| Synonyms: | CORNIFIN; GADD33; SPR-IB; SPRR1; cornifin-B; 14.9 kDa pancornulin; small proline-rich protein IB; small proline rich protein 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagttcccagcagcagaagcagccctgcatcccaccccctcagcttcagcagcagcaggtgaaacagccttgccagcctccacctcaggaaccatgcatccccaaaaccaaggagccctgccaccccaaggtgcctgagccctgccaccccaaagtgcctgagccctgccagcccaaggttccagagccatgccaccccaaggtgcctgagccctgcccttcaatagtcactccagcaccagcccagcagaagaccaagcagaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - natural cytotoxicity triggering receptor 3 - fibroblast growth factor receptor-like 1 - hydroxypyruvate isomerase homolog (E. coli) - integrin alpha FG-GAP repeat containing 1 |