Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DCD-dermcidin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCD-dermcidin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062682 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCD |
| Origin species: | Human |
| Product name: | DCD-dermcidin Gene |
| Size: | 2ug |
| Accessions: | BC062682 |
| Gene id: | 117159 |
| Gene description: | dermcidin |
| Synonyms: | DCD-1; AIDD; DSEP; HCAP; PIF; dermcidin; diffusible survival/evasion peptide; preproteolysin; proteolysis inducing factor; survival promoting peptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaaggaagcagagatccagccttctggaaaaaggcctagacggagcaaaaaaagctgtggggggactcggaaaactaggaaaagatgcagtcgaagatctagaaagcgtgggtaaaggagccgtccatgacgttaaagacgtccttgactcagtactatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin C - rhotekin - resistin - versican |