LIAS-lipoic acid synthetase Gene

View larger

LIAS-lipoic acid synthetase Gene

Reference: PTXBC062751

Condition: New product

Print

Data sheet of LIAS-lipoic acid synthetase Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about LIAS-lipoic acid synthetase Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC062751
Product type:	DNA & cDNA
Ncbi symbol:	LIAS
Origin species:	Human
Product name:	LIAS-lipoic acid synthetase Gene
Size:	2ug
Accessions:	BC062751
Gene id:	11019
Gene description:	lipoic acid synthetase
Synonyms:	HGCLAS; HUSSY-01; LAS; LIP1; PDHLD; lipoyl synthase, mitochondrial; lip-syn; lipoate synthase; lipoic acid synthetase
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtctctacgctgcggggatgcagcccgcaccctggggccccgggtatttgggagatatttttgcagcccagtcagaccgttaagctccttgccagataaaaaaaaggaactcctacagaatggaccagaccttcaagattttgtatctggtgatcttgcagacaggagcacctgggatgaatataaaggaaacctaaaacgccagaaaggagaaaggttaagactacctccatggctaaagacagagattcccatggggaaaaattacaataaactgaaaaatactttgcggaatttaaatctccatacagtatgtgaggaagctcgatgtcccaatattggagagtgttggggaggtggagaatatgccaccgccacagccacgatcatggtagggccagcctcaacctctatggctttagtctag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- ribosomal protein L23 - interleukin 9 receptor - glycyl-tRNA synthetase - carbonic anhydrase VIII

Reviews

Be the first to write your review !

Buy LIAS-lipoic acid synthetase Gene now