Cart 8 Product Products 1 200,50 € (empty)
-
1 x LOC400713-...113,40 € -
1 x CRIP1-cyst...113,40 € -
1 x CCR1-chemo...121,50 € -
1 x PPP1R11-pr...113,40 € -
-
-
1 x CXCL5-chem...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
1 200,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 200,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 200,50 €
Data sheet of SFTPD-surfactant protein D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFTPD-surfactant protein D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022318 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFTPD |
| Origin species: | Human |
| Product name: | SFTPD-surfactant protein D Gene |
| Size: | 2ug |
| Accessions: | BC022318 |
| Gene id: | 6441 |
| Gene description: | surfactant protein D |
| Synonyms: | COLEC7; PSP-D; SFTP4; SP-D; pulmonary surfactant-associated protein D; collectin-7; lung surfactant protein D; pulmonary surfactant apoprotein; surfactant-associated protein, pulmonary 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctcttcctcctctctgcactggtcctgctcacacagcccctgggctacctggaagcaggaatgaagacctactcccacagaacaatgcccagtgcttgcaccctggtcatgtgtagctcagtggagagtggcctgcctggtcgcgatggacgggatgggagagagggccctcggggcgagaagggggacccaggtttgccaggagctgcagggcaagcagggatgcctggacaagctggcccagttgggcccaaaggggacaatggctctgttggagaacctggaccaaagggagacactgggccaagtggacctccaggacctcccggtgtgcctggtccagctggaagagaaggtcccctggggaagcaggggaacataggacctcagggcaagccaggcccaaaaggagaagctgggcccaaaggagaagtaggtgccccaggcatgcagggctcggcaggggcaagaggcctcgcaggccctaagggagagcgaggtgtccctggtgagcgtggagtccctggaaacacaggggcagcagggtctgctggagccatgggtccccagggaagtccaggtgccaggggacccccgggattgaagggggacaaaggcattcctggagacaaaggagcaaagggagaaagtgggcttccagatgttgcttctctgaggcagcaggttgaggccttacagggacaagtacagcacctccaggctgctttctctcagtataagaaagttgagctcttcccaaatggccaaagtgtcggggagaagattttcaagacagcaggctttgtaaaaccatttacggaggcacagctgctgtgcacacaggctggtggacagttggcctctccacgctctgccgctgagaatgccgccttgcaacagctggtcgtagctaagaacgaggctgctttcctgagcatgactgattccaagacagagggcaagttcacctaccccacaggagagtccctggtctattccaactgggccccagggaagcccaacgatgatggcgggtcagaggactgtgtggagatcttcaccaatggcaagtggaatgacagggcttgtggagaaaagcgtcttgtggtctgcgagttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RecQ protein-like 4 - WDFY family member 4 - defensin, beta 127 - crystallin, beta A1 |