PTXBC003583
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003583 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FTO |
| Origin species: | Human |
| Product name: | FTO-fat mass and obesity associated Gene |
| Size: | 2ug |
| Accessions: | BC003583 |
| Gene id: | 79068 |
| Gene description: | fat mass and obesity associated |
| Synonyms: | FTO, alpha-ketoglutarate dependent dioxygenase; alpha-ketoglutarate-dependent dioxygenase FTO; ALKBH9; BMIQ14; GDFD; AlkB homolog 9; fat mass and obesity associated; fat mass and obesity-associated protein |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatgccagggcagagaggagtgttggtgccagtcacgaattgcccgaacattacctgctgatcagaagccagaatgtcggccatactgggaaaaggatgatgcttcgatgcctctgccgtttgacctcacagacatcgtttcagaactcagaggtcagcttctggaagcaaaaccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - spermatogenesis associated 6 - HMG-box transcription factor 1 - suppression of tumorigenicity 7 - nucleophosmin/nucleoplasmin, 3 |