Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TFB1M-transcription factor B1, mitochondrial Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFB1M-transcription factor B1, mitochondrial Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017788 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFB1M |
| Origin species: | Human |
| Product name: | TFB1M-transcription factor B1, mitochondrial Gene |
| Size: | 2ug |
| Accessions: | BC017788 |
| Gene id: | 51106 |
| Gene description: | transcription factor B1, mitochondrial |
| Synonyms: | CGI-75; CGI75; mtTFB; mtTFB1; dimethyladenosine transferase 1, mitochondrial; S-adenosylmethionine-6-N', N'-adenosyl(rRNA) dimethyltransferase 1; h-mtTFB1; hTFB1M; homolog of yeast mitochondrial transcription factor B; mitochondrial 12S rRNA dimethylase 1; mitochondrial dimethyladenosine transferase 1; transcription factor B1, mitochondrial |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcctccggaaaactcagcacttgccgtctccctccgttgcccacgattcgagaaatcattaagttgttaagactgcaagcagcgaagcagctatcacagaatttcctcctggacttgaggctgacagataagattgtaaggaaagctggcaatctgacaaatgcttatgtttacgaagtgggccctgggccagggggaatcacaagatctattcttaatgccgacgtcgctgaacttctggtggttgaaaaggacactcgatttattcctggattacagatgctttctgatgcagcacctgggaaactgagaattgttcatggagatgtcttgacatttaaggtagaaaaggctttttcagaaagtcttaaaagaccctgggaagatgatcctccaaatgtacatattattggaaatctgccttttagtgtttcaactccactgattatcaagtggcttgaaaatatttcctgtagagatggaccttttgtttatggcagaactcagatgactttgacttttcaaaaggaagtggcagagagacttgcagccaatacaggaagcaaacagcgtagtcgcctctctgttatggctcagtacctctgcaatgttcgacacatctttacgattccaggacaagcttttgtccccaaaccagaggtggacgtgggcgtggtgcacttcactcccttgatacagcccaagatagagcagccattcaagctggtggaaaaagtggttcagaatgtatttcagttccgaaggaaatactgccatcgagggctcagaatgttattccctgaagcgcagcgcttggaaagcacgggcaggctgttagagttggcagacatagaccctactcttcggccccgccagctctccatctcacactttaagagcctctgtgatgtatacagaaaaatgtgtgatgaagacccacaactctttgcatataatttcagagaagaactcaagcgaagaaaaagcaaaaatgaagaaaaagaagaggatgacgcagagaattacagactctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 15 open reading frame 29 - zinc finger, CCHC domain containing 7 - chromosome 6 open reading frame 118 - chromosome 16 open reading frame 87 |