Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATF2-activating transcription factor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATF2-activating transcription factor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026175 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATF2 |
| Origin species: | Human |
| Product name: | ATF2-activating transcription factor 2 Gene |
| Size: | 2ug |
| Accessions: | BC026175 |
| Gene id: | 1386 |
| Gene description: | activating transcription factor 2 |
| Synonyms: | histone acetyltransferase ATF2; activating transcription factor 2 splice variant ATF2-var2; CRE-BP1; CREB-2; CREB2; HB16; TREB7; cyclic AMP-dependent transcription factor ATF-2; cAMP response element-binding protein CRE-BP1; cAMP responsive element binding protein 2, formerly; cAMP-dependent transcription factor ATF-2; cyclic AMP-responsive element-binding protein 2; activating transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaattcaagttacatgtgaattctgccaggcaatacaaggacctgtggaatatgagtgatgacaaaccctttctatgtactgcgcctggatgtggccagcgttttaccaacgaggatcatttggctgtccataaacataaacatgagatgacactgaaatttggtccagcacgtaatgacagtgtcattgtggctgatcagaccccaacaccaacaagattcttgaaaaactgtgaagaagtgggtttgtttaatgagttggcgagtccatttgagaatgaattcaagaaagcttcagaagatgacattaaaaaaatgcctctagatttatcccctcttgcaacacctatcataagaagcaaaattgaggagccttctgttgtagaaacaactcaccaggatagtcctttacctcacccagagtctactaccagtgatgagaaggaagtaccattggcacaaactgcacagcccacatcagctattgttcgtccagcatcattacaggttcccaatgtgctgcttacaagttctgactcaagtgtaattattcagcaggcagtaccttcaccaacctcaagtactgtaatcacccaggcaccatcctctaacaggccaattgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIB - activating transcription factor 1 - lipopolysaccharide binding protein - calsequestrin 2 (cardiac muscle) |