ATF2-activating transcription factor 2 Gene View larger

ATF2-activating transcription factor 2 Gene

PTXBC026175

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATF2-activating transcription factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATF2-activating transcription factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026175
Product type: DNA & cDNA
Ncbi symbol: ATF2
Origin species: Human
Product name: ATF2-activating transcription factor 2 Gene
Size: 2ug
Accessions: BC026175
Gene id: 1386
Gene description: activating transcription factor 2
Synonyms: histone acetyltransferase ATF2; activating transcription factor 2 splice variant ATF2-var2; CRE-BP1; CREB-2; CREB2; HB16; TREB7; cyclic AMP-dependent transcription factor ATF-2; cAMP response element-binding protein CRE-BP1; cAMP responsive element binding protein 2, formerly; cAMP-dependent transcription factor ATF-2; cyclic AMP-responsive element-binding protein 2; activating transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaattcaagttacatgtgaattctgccaggcaatacaaggacctgtggaatatgagtgatgacaaaccctttctatgtactgcgcctggatgtggccagcgttttaccaacgaggatcatttggctgtccataaacataaacatgagatgacactgaaatttggtccagcacgtaatgacagtgtcattgtggctgatcagaccccaacaccaacaagattcttgaaaaactgtgaagaagtgggtttgtttaatgagttggcgagtccatttgagaatgaattcaagaaagcttcagaagatgacattaaaaaaatgcctctagatttatcccctcttgcaacacctatcataagaagcaaaattgaggagccttctgttgtagaaacaactcaccaggatagtcctttacctcacccagagtctactaccagtgatgagaaggaagtaccattggcacaaactgcacagcccacatcagctattgttcgtccagcatcattacaggttcccaatgtgctgcttacaagttctgactcaagtgtaattattcagcaggcagtaccttcaccaacctcaagtactgtaatcacccaggcaccatcctctaacaggccaattgtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - general transcription factor IIB
- activating transcription factor 1
- lipopolysaccharide binding protein
- calsequestrin 2 (cardiac muscle)

Reviews

Buy ATF2-activating transcription factor 2 Gene now

Add to cart