Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RBBP6-retinoblastoma binding protein 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBBP6-retinoblastoma binding protein 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBBP6 |
| Origin species: | Human |
| Product name: | RBBP6-retinoblastoma binding protein 6 Gene |
| Size: | 2ug |
| Accessions: | BC029352 |
| Gene id: | 5930 |
| Gene description: | retinoblastoma binding protein 6 |
| Synonyms: | E3 ubiquitin-protein ligase RBBP6; MY038; P2P-R; PACT; RBQ-1; SNAMA; RB-binding Q-protein 1; p53-associated cellular protein of testis; proliferation potential-related protein; protein P2P-R; retinoblastoma binding protein 6; retinoblastoma-binding Q protein 1; retinoblastoma-binding protein 6; RB binding protein 6, ubiquitin ligase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctgtgtgcattataaattttcctctaaactcaactatgataccgtcacctttgatgggctccacatctccctctgcgacttaaagaagcagattatggggagagagaagctgaaagctgccgactgcgacctgcagatcaccaatgcgcagacgaaagaagaatatactgatgataatgctctgattcctaagaattcttctgtaattgttagaagaattcctattggaggtgttaaatctacaagcaagacatatgttataagtcgaactgaaccagcgatggcaactacaaaagcagtatgtaaaaacacaatctcacactttttctacacattgcttttacctttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chloride intracellular channel 2 - chloride intracellular channel 5 - retinol binding protein 4, plasma - occludin/ELL domain containing 1 |