Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NT5C-5', 3'-nucleotidase, cytosolic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NT5C-5', 3'-nucleotidase, cytosolic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022334 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NT5C |
| Origin species: | Human |
| Product name: | NT5C-5', 3'-nucleotidase, cytosolic Gene |
| Size: | 2ug |
| Accessions: | BC022334 |
| Gene id: | 30833 |
| Gene description: | 5', 3'-nucleotidase, cytosolic |
| Synonyms: | DNT; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2; cdN; dNT-1; 5'(3')-deoxyribonucleotidase, cytosolic type; 5' nucleotidase, deoxy (pyrimidine), cytosolic type C; cytosolic 5',3'-pyrimidine nucleotidase; deoxy-5'-nucleotidase 1; epididymis luminal protein 74; uridine 5'-monophosphate phosphohydrolase 2; uridine 5-prime monophosphate hydrolase 2; 5', 3'-nucleotidase, cytosolic |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcggagcgtgcgcgtgctggtggacatggacggcgtcctggccgacttcgaggccggcctcctgcggggcttccgccgccgcttccctgaggagccgcacgtgccgctggagcagcgccgcggcttcctggcccgcgagcagtaccgcgccctgcggcccgacctggcggataaagtggccagtgtgtacgaagccctgggctttttcctggacctggagcccatcccgggagccttggacgctgtgcgggagatgaacgacctaccggacacgcaggtcttcatctgcaccagccccctgctgaagtaccaccactgtgtgggtgagaagtaccgctgggtggagcagcacctggggccccagttcgtagaacgaattatcctgacaagggacaagacggtggtcttgggggacctgctcattgatgacaaggacacagttcgaggccaggaggagaccccaagctgggagcacatcttgttcacctgctgccacaatcggcacctggtcctgcccccgacaaggagacggctgctctcctggagtgacaactggagggagatcttagatagcaagcgcggagctgcgcagcgggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAD51 associated protein 1 - junctional adhesion molecule 2 - spermatogenesis associated 4 - complement factor H-related 2 |