Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD302-CD302 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD302-CD302 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020646 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD302 |
| Origin species: | Human |
| Product name: | CD302-CD302 molecule Gene |
| Size: | 2ug |
| Accessions: | BC020646 |
| Gene id: | 9936 |
| Gene description: | CD302 molecule |
| Synonyms: | CD302 molecule; CD302 antigen; BIMLEC; CLEC13A; DCL-1; DCL1; C-type lectin domain family 13, member A; DEC205-associated C-type lectin 1; type I transmembrane C-type lectin receptor DCL-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgataagcatacataatgaagaagaaaatgcttttatactggatactttgaaaaagcaatggaaaggcccagatgatatcctactaggcatgttttatgacacagatgatgcgagtttcaagtggtttgataattcaaatatgacatttgataagtggacagaccaagatgatgatgaggatttagttgacacctgtgcttttctgcacatcaagacaggtgaatggaaaaaaggaaattgtgaagtttcttctgtggaaggaacactatgcaaaacagctatcccatacaaaaggaaatatttatcagataaccacattttaatatcagcattggtgattgctagcacggtaattttgacagttttgggagcaatcatttggttcctgtacaaaaaacattctgattctcgtttcaccacagttttttcaaccgcaccccaatcaccttataatgaagactgtgttttggtagttggagaagaaaatgaatatcctgttcaatttgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth hormone 2 - arginase, liver - arylsulfatase F - calcyphosine 2 |