Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL20-chemokine (C-C motif) ligand 20 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL20-chemokine (C-C motif) ligand 20 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020698 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL20 |
| Origin species: | Human |
| Product name: | CCL20-chemokine (C-C motif) ligand 20 Gene |
| Size: | 2ug |
| Accessions: | BC020698 |
| Gene id: | 6364 |
| Gene description: | chemokine (C-C motif) ligand 20 |
| Synonyms: | CKb4; Exodus; LARC; MIP-3-alpha; MIP-3a; MIP3A; SCYA20; ST38; C-C motif chemokine 20; CC chemokine LARC; beta chemokine exodus-1; chemokine (C-C motif) ligand 20; liver and activation-regulated chemokine; macrophage inflammatory protein 3 alpha; small inducible cytokine subfamily A (Cys-Cys), member 20; small-inducible cytokine A20; C-C motif chemokine ligand 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctgtaccaagagtttgctcctggctgctttgatgtcagtgctgctactccacctctgcggcgaatcagaagcaagcaactttgactgctgtcttggatacacagaccgtattcttcatcctaaatttattgtgggcttcacacggcagctggccaatgaaggctgtgacatcaatgctatcatctttcacacaaagaaaaagttgtctgtgtgcgcaaatccaaaacagacttgggtgaaatatattgtgcgtctcctcagtaaaaaagtcaagaacatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) ligand 11 - ADP-ribosylation factor-like 15 - zinc finger, AN1-type domain 1 - G protein-coupled receptor 183 |