Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ARPP-21-cyclic AMP-regulated phosphoprotein, 21 kD Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARPP-21-cyclic AMP-regulated phosphoprotein, 21 kD Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017805 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARPP-21 |
| Origin species: | Human |
| Product name: | ARPP-21-cyclic AMP-regulated phosphoprotein, 21 kD Gene |
| Size: | 2ug |
| Accessions: | BC017805 |
| Gene id: | 10777 |
| Gene description: | cyclic AMP-regulated phosphoprotein, 21 kD |
| Synonyms: | ARPP-21; R3HDM3; RCS; TARPP; cAMP-regulated phosphoprotein 21; R3H domain containing 3; cAMP regulated phosphoprotein 21kDa; cyclic AMP-regulated phosphoprotein, 21 kD; thymocyte cAMP-regulated phosphoprotein; cAMP regulated phosphoprotein 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgagcaaggagacctgaatcaggcaatagcagaggaaggagggactgagcaggagacggccactccagagaacggcattgttaaatcagaaagtctggatgaagaggagaaactggaactgcagaggcggctggaggctcagaatcaagaaagaagaaaatccaagtcaggagcaggaaaaggtaaactgactcgcagtcttgctgtctgtgaggaatcttctgccagaccaggaggtgaaagtcttcaggatcagactctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily A, member 3 - La ribonucleoprotein domain family, member 4 - glycosyltransferase-like domain containing 1 - hydroxysteroid (17-beta) dehydrogenase 11 |