Login to display prices
Login to display prices
MB-myoglobin Gene View larger

MB-myoglobin Gene

PTXBC018001

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MB-myoglobin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MB-myoglobin Gene

Proteogenix catalog: PTXBC018001
Ncbi symbol: MB
Product name: MB-myoglobin Gene
Size: 2ug
Accessions: BC018001
Gene id: 4151
Gene description: myoglobin
Synonyms: PVALB; myoglobgin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcgtctgaggacttaaagaagcatggtgccaccgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgaggcagagattaagcccctggcacagtcgcatgccaccaagcacaagatccccgtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatcccggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaaggacatggcctccaactacaaggagctgggcttccagggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: