SLC35B2-solute carrier family 35, member B2 Gene View larger

SLC35B2-solute carrier family 35, member B2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC35B2-solute carrier family 35, member B2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC35B2-solute carrier family 35, member B2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024288
Product type: DNA & cDNA
Ncbi symbol: SLC35B2
Origin species: Human
Product name: SLC35B2-solute carrier family 35, member B2 Gene
Size: 2ug
Accessions: BC024288
Gene id: 347734
Gene description: solute carrier family 35, member B2
Synonyms: PAPST1; SLL; UGTrel4; adenosine 3'-phospho 5'-phosphosulfate transporter 1; 3'-phosphoadenosine 5'-phosphosulfate transporter; PAPS transporter 1; solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2; solute carrier family 35 member B2 variant 2; solute carrier family 35 member B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgccagatggtgggcagtggtggtgctggctgcgttcccctccctaggggcaggtggggagactcccgaagcccctccggagtcatggacccagctatggttcttccgatttgtggtgaatgctgctggctatgccagctttatggtacctggctacctcctggtgcagtacttcaggcggaagaactacctggagaccggtaggggcctctgctttcccctggtgaaagcttgtgtgtttggcaatgagcccaaggcctctgatgaggttcccctggcgccccgaacagaggcggcagagaccaccccgatgtggcaggccctgaaactgctcttctgtgccacagggctccaggtgtcttatctgacttggggtgtgctgcaggaaagagtgatgacccgcagctatggggccacagccacatcaccgggtgagcgctttacggactcgcagttcctggtgctaatgaaccgagtgctggcactgattgtggctggcctctcctgtgttctctgcaagcagccccggcatggggcacccatgtaccggtactcctttgccagcctgtccaatgtgcttagcagctggtgccaatacgaagctcttaagttcgtcagcttccccacccaggtgctggccaaggcctctaaggtgatccctgtcatgctgatgggaaagcttgtgtctcggcgcagctacgaacactgggagtacctgacagccaccctcatctccattggggtcagcatgtttctgctatccagcggaccagagccccgcagctccccagccaccacactctcaggcctcatcttactggcaggttatattgcttttgacagcttcacctcaaactggcaggatgccctgtttgcctataagatgtcatcggtgcagatgatgtttggggtcaatttcttctcctgcctcttcacagtgggctcactgctagaacagggggccctactggagggaacccgcttcatggggcgacacagtgagtttgctgcccatgccctgctactctccatctgctccgcatgtggccagctcttcatcttttacaccattgggcagtttggggctgccgtcttcaccatcatcatgaccctccgccaggcctttgccatccttctttcctgccttctctatggccacactgtcactgtggtgggagggctgggggtggctgtggtctttgctgccctcctgctcagagtctacgcgcggggccgtctaaagcaacggggaaagaaggctgtgcctgttgagtctcctgtgcagaaggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - xin actin-binding repeat containing 2
- interleukin 1 family, member 7 (zeta)
- basic leucine zipper nuclear factor 1
- ribosomal protein L23a pseudogene

Buy SLC35B2-solute carrier family 35, member B2 Gene now

Add to cart