TREX1-three prime repair exonuclease 1 Gene View larger

TREX1-three prime repair exonuclease 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TREX1-three prime repair exonuclease 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TREX1-three prime repair exonuclease 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023630
Product type: DNA & cDNA
Ncbi symbol: TREX1
Origin species: Human
Product name: TREX1-three prime repair exonuclease 1 Gene
Size: 2ug
Accessions: BC023630
Gene id: 11277
Gene description: three prime repair exonuclease 1
Synonyms: 3'-5' exonuclease TREX1; AGS1; CRV; DRN3; HERNS; three-prime repair exonuclease 1; 3' repair exonuclease 1; DNase III; deoxyribonuclease III; three prime repair exonuclease 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccctggagctcgcagacagggcaggattgtgcagggaaggcctgagatgtgcttctgcccaccccctaccccactccctccccttcggatcttaacactgggcactcacacacccaccccatgctcctctccaggctcagcagcaggtacgtacccaaccatgggctcgcaggccctgcccccggggcccatgcagaccctcatctttttcgacatggaggccactggcttgcccttctcccagcccaaggtcacggagctgtgcctgctggctgtccacagatgtgccctggagagcccccccacctctcaggggccacctcccacagttcctccaccaccgcgtgtggtagacaagctctccctgtgtgtggctccggggaaggcctgcagccctgcagccagcgagatcacaggtctgagcacagctgtgctggcagcgcatgggcgtcaatgttttgatgacaacctggccaacctgctcctagccttcctgcggcgccagccacagccctggtgcctggtggcacacaatggtgaccgctacgacttccccctgctccaagcagagctggctatgctgggcctcaccagtgctctggatggtgccttctgtgtggatagcatcactgcgctgaaggccctggagcgagcaagcagcccctcagaacacggcccaaggaagagctacagcctaggcagcatctacactcgcctgtatgggcagtcccctccagactcgcacacggctgagggtgatgtcctggccctgctcagcatctgtcagtggagaccacaggccctgctgcggtgggtggatgctcacgccaggcctttcggcaccatcaggcccatgtatggggtcacagcctctgctaggaccaagccaagaccatctgctgtcacaaccactgcacacctggccacaaccaggaacactagtcccagccttggagagagcaggggtaccaaggatcttcctccagtgaaggaccctggagccctatccagggaggggctgctggccccactgggtctgctggccatcctgaccttggcagtagccacactgtatggactatccctggccacacctggggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - uridine-cytidine kinase 1-like 1
- hypothetical protein MGC27345
- hypothetical protein MGC24125
- hemochromatosis type 2 (juvenile)

Buy TREX1-three prime repair exonuclease 1 Gene now

Add to cart