Login to display prices
Login to display prices
TREX1-three prime repair exonuclease 1 Gene View larger

TREX1-three prime repair exonuclease 1 Gene

PTXBC023630

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TREX1-three prime repair exonuclease 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TREX1-three prime repair exonuclease 1 Gene

Proteogenix catalog: PTXBC023630
Ncbi symbol: TREX1
Product name: TREX1-three prime repair exonuclease 1 Gene
Size: 2ug
Accessions: BC023630
Gene id: 11277
Gene description: three prime repair exonuclease 1
Synonyms: 3'-5' exonuclease TREX1; AGS1; CRV; DRN3; HERNS; three-prime repair exonuclease 1; 3' repair exonuclease 1; DNase III; deoxyribonuclease III; three prime repair exonuclease 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccctggagctcgcagacagggcaggattgtgcagggaaggcctgagatgtgcttctgcccaccccctaccccactccctccccttcggatcttaacactgggcactcacacacccaccccatgctcctctccaggctcagcagcaggtacgtacccaaccatgggctcgcaggccctgcccccggggcccatgcagaccctcatctttttcgacatggaggccactggcttgcccttctcccagcccaaggtcacggagctgtgcctgctggctgtccacagatgtgccctggagagcccccccacctctcaggggccacctcccacagttcctccaccaccgcgtgtggtagacaagctctccctgtgtgtggctccggggaaggcctgcagccctgcagccagcgagatcacaggtctgagcacagctgtgctggcagcgcatgggcgtcaatgttttgatgacaacctggccaacctgctcctagccttcctgcggcgccagccacagccctggtgcctggtggcacacaatggtgaccgctacgacttccccctgctccaagcagagctggctatgctgggcctcaccagtgctctggatggtgccttctgtgtggatagcatcactgcgctgaaggccctggagcgagcaagcagcccctcagaacacggcccaaggaagagctacagcctaggcagcatctacactcgcctgtatgggcagtcccctccagactcgcacacggctgagggtgatgtcctggccctgctcagcatctgtcagtggagaccacaggccctgctgcggtgggtggatgctcacgccaggcctttcggcaccatcaggcccatgtatggggtcacagcctctgctaggaccaagccaagaccatctgctgtcacaaccactgcacacctggccacaaccaggaacactagtcccagccttggagagagcaggggtaccaaggatcttcctccagtgaaggaccctggagccctatccagggaggggctgctggccccactgggtctgctggccatcctgaccttggcagtagccacactgtatggactatccctggccacacctggggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: