Login to display prices
Login to display prices
ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene View larger

ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene

PTXBC032126

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene

Proteogenix catalog: PTXBC032126
Ncbi symbol: ATPAF2
Product name: ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene
Size: 2ug
Accessions: BC032126
Gene id: 91647
Gene description: ATP synthase mitochondrial F1 complex assembly factor 2
Synonyms: ATP12p; LP3663; MC5DN1; ATP synthase mitochondrial F1 complex assembly factor 2; ATP12 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaggagctgcctccggctgcgggacgggggacgccgtctcctgaatcggccggcgggtggccccagcgcttctatgagtccggggccaaccatcccgtctccagcccgggcttacgccccgccgacagaaaggaagaggttttatcagaatgtcagcatcacacagggtgaaggtggctttgagataaacctggaccacaggaagctgaaaactccccaagccaagctctttaccgtccccagcgaggccctggccattgcagtggctactgagtgggattcccagcaggataccatcaagtactacaccatgcacctgaccacattgtgcaacacatcattggacaacccaacccagagaaacaaggatcagctgatccgggcagccgtgaagtttctggacaccgacaccatctgctacagggtggaggagcccgagacattagtggaacttcaaaggaatgagtgggatccaatcatcgaatgggctgagaaaagatacggcgtggagatcagttcctccaccagcataatgggacccagcatccctgccaaaactcgggaggtgctcgtcagccacctggcatcttacaacacatgggctttacaagggattgagtttgtagctgcccagctcaagtccatggtgctaaccttgggcctgattgacctgcgcctgacagtggagcaggccgtgctgctgtcacgcctggaggaggagtaccagatccagaagtggggcaacattgagtgggcccatgactatgagctgcaggagctgcgggcccgcaccgccgccggcaccctcttcatccatctctgctccgagagcaccacagtcaagcacaagctcctgaaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: