ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene View larger

ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032126
Product type: DNA & cDNA
Ncbi symbol: ATPAF2
Origin species: Human
Product name: ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene
Size: 2ug
Accessions: BC032126
Gene id: 91647
Gene description: ATP synthase mitochondrial F1 complex assembly factor 2
Synonyms: ATP12p; LP3663; MC5DN1; ATP synthase mitochondrial F1 complex assembly factor 2; ATP12 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaggagctgcctccggctgcgggacgggggacgccgtctcctgaatcggccggcgggtggccccagcgcttctatgagtccggggccaaccatcccgtctccagcccgggcttacgccccgccgacagaaaggaagaggttttatcagaatgtcagcatcacacagggtgaaggtggctttgagataaacctggaccacaggaagctgaaaactccccaagccaagctctttaccgtccccagcgaggccctggccattgcagtggctactgagtgggattcccagcaggataccatcaagtactacaccatgcacctgaccacattgtgcaacacatcattggacaacccaacccagagaaacaaggatcagctgatccgggcagccgtgaagtttctggacaccgacaccatctgctacagggtggaggagcccgagacattagtggaacttcaaaggaatgagtgggatccaatcatcgaatgggctgagaaaagatacggcgtggagatcagttcctccaccagcataatgggacccagcatccctgccaaaactcgggaggtgctcgtcagccacctggcatcttacaacacatgggctttacaagggattgagtttgtagctgcccagctcaagtccatggtgctaaccttgggcctgattgacctgcgcctgacagtggagcaggccgtgctgctgtcacgcctggaggaggagtaccagatccagaagtggggcaacattgagtgggcccatgactatgagctgcaggagctgcgggcccgcaccgccgccggcaccctcttcatccatctctgctccgagagcaccacagtcaagcacaagctcctgaaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 8 (five membrane-spanning domains)
- protein kinase (cAMP-dependent, catalytic) inhibitor beta
- cytochrome P450, family 19, subfamily A, polypeptide 1
- ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D

Buy ATPAF2-ATP synthase mitochondrial F1 complex assembly factor 2 Gene now

Add to cart