Login to display prices
Login to display prices
ANGPTL4-angiopoietin-like 4 Gene View larger

ANGPTL4-angiopoietin-like 4 Gene

PTXBC023647

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANGPTL4-angiopoietin-like 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANGPTL4-angiopoietin-like 4 Gene

Proteogenix catalog: PTXBC023647
Ncbi symbol: ANGPTL4
Product name: ANGPTL4-angiopoietin-like 4 Gene
Size: 2ug
Accessions: BC023647
Gene id: 51129
Gene description: angiopoietin-like 4
Synonyms: ARP4; FIAF; HARP; HFARP; NL2; PGAR; TGQTL; UNQ171; pp1158; angiopoietin-related protein 4; PPARG angiopoietin related protein; fasting-induced adipose factor; hepatic angiopoietin-related protein; hepatic fibrinogen/angiopoietin-related protein; peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein; angiopoietin like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggtgctccgacggccggggcagccctgatgctctgcgccgccaccgccgtgctactgagcgctcagggcggacccgtgcagtccaagtcgccgcgctttgcgtcctgggacgagatgaatgtcctggcgcacggactcctgcagctcggccaggggctgcgcgaacacgcggagcgcacccgcagtcagctgagcgcgctggagcggcgcctgagcgcgtgcgggtccgcctgtcagggaaccgaggggtccaccgacctcccgttagcccctgagagccgggtggaccctgaggtccttcacagcctgcagacacaactcaaggctcagaacagcaggatccagcaactcttccacaaggtggcccagcagcagcggcacctggagaagcagcacctgcgaattcagcatctgcaaagccagtttggcctcctggaccacaagcacctagaccatgaggtggccaagcctgcccgaagaaagaggctgcccgagatggcccagccagttgacccggctcacaatgtcagccgcctgcaccggctgcccagggattgccaggagctgttccaggttggggagaggcagagtggactatttgaaatccagcctcaggggtctccgccatttttggtgaactgcaagatgacctcagatggaggctggacagtaattcagaggcgccacgatggctcagtggacttcaaccggccctgggaagcctacaaggcggggtttggggatccccacggcgagttctggctgggtctggagaaggtgcatagcatcacgggggaccgcaacagccgcctggccgtgcagctgcgggactgggatggcaacgccgagttgctgcagttctccgtgcacctgggtggcgaggacacggcctatagcctgcagctcactgcacccgtggccggccagctgggcgccaccaccgtcccacccagcggcctctccgtacccttctccacttgggaccaggatcacgacctccgcagggacaagaactgcgccaagagcctctctggaggctggtggtttggcacctgcagccattccaacctcaacggccagtacttccgctccatcccacagcagcggcagaagcttaagaagggaatcttctggaagacctggcggggccgctactacccactgcaggccaccaccatgttgatccagcccatggcagcagaggcagcctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: