C16orf59-chromosome 16 open reading frame 59 Gene View larger

C16orf59-chromosome 16 open reading frame 59 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf59-chromosome 16 open reading frame 59 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf59-chromosome 16 open reading frame 59 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018719
Product type: DNA & cDNA
Ncbi symbol: C16orf59
Origin species: Human
Product name: C16orf59-chromosome 16 open reading frame 59 Gene
Size: 2ug
Accessions: BC018719
Gene id: 80178
Gene description: chromosome 16 open reading frame 59
Synonyms: uncharacterized protein C16orf59; chromosome 16 open reading frame 59
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagcccgaacccccaggcctggggcgggcctcagggaccagcaaatggccccatccgctgctcctcaggccccagaagccttcacactcaaggagaaggggcacctgctgcggctgcctgcggcattcaggaaagcagcttcccagaactcgagcctgtgggcccagctcagttccacacagaccagtgattccacggatgccgccgctgccaaaacccagttcctccagaacatgcagacagcttcaggcgggccccagcccaggctcagtgctgtggaggtggaggcggaggcggggcgcctgcggaaggcctgctcgctgctgagactgcgcatgagggaggagctctcggcagcccccatggactggatgcaggagtaccgctgcctgctcacgctggaggggctgcaggccatggtgggccagtgtctgcacaggctgcaggagctgcgtgcagcggtggcggaacagccaccaagaccatgtcctgtggggaggccccccggagcctcgccgtcctgtgggggtagagcggagcctgcatggagcccccagctgcttgtctactccagcacccaggagctgcagaccctggcggccctcaagctgcgagtggctgtgctggaccagcagatccacttggaaaaggtcctgatggctgaactcctccccctggtaagcgctgcacagccgcaggggccgccctggctggccctgtgccgggctgtgcacagcctgctctgcgagggaggagcacgtgtccttaccatcctgcgggatgaacctgcagtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylglycerophosphate synthase 1
- chromosome 18 open reading frame 32
- chromosome 19 open reading frame 28
- non-SMC condensin I complex, subunit H

Buy C16orf59-chromosome 16 open reading frame 59 Gene now

Add to cart