Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TXNDC9-thioredoxin domain containing 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TXNDC9-thioredoxin domain containing 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024223 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TXNDC9 |
| Origin species: | Human |
| Product name: | TXNDC9-thioredoxin domain containing 9 Gene |
| Size: | 2ug |
| Accessions: | BC024223 |
| Gene id: | 10190 |
| Gene description: | thioredoxin domain containing 9 |
| Synonyms: | APACD; PHLP3; thioredoxin domain-containing protein 9; ATP binding protein associated with cell differentiation; protein 1-4; thioredoxin domain containing 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagctgatgcatctgttgacatgttttccaaagtcctggagcatcagctgcttcagactaccaaactggtggaagaacatttggattctgaaattcaaaaactggatcagatggatgaggatgaattggaacgccttaaagaaaagagactccaggcactaaggaaagctcaacagcagaaacaagaatggctttctaaaggacatggggaatacagagaaatccctagtgaaagagacttttttcaagaagtcaaggagagtgaaaatgtggtttgccatttctacagagactccacattcaggtgtaaaatactagacagacatctggcaatattgtccaagaaacacctcgagaccaaatttttgaagctgaatgtggaaaaagcacctttcctttgtgagagactgcatatcaaagtcattcccacactagcactgctaaaagatgggaaaacacaagattatgttgttgggtttactgacctaggaaatacagatgacttcaccacagaaactttagaatggaggctcggttcttctgacattcttaattacaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ20433 - ELMO/CED-12 domain containing 3 - lysophosphatidic acid receptor 5 - TNF receptor-associated factor 1 |