Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H3D-histone cluster 1, H3d Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H3D-histone cluster 1, H3d Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031333 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H3D |
| Origin species: | Human |
| Product name: | HIST1H3D-histone cluster 1, H3d Gene |
| Size: | 2ug |
| Accessions: | BC031333 |
| Gene id: | 8351 |
| Gene description: | histone cluster 1, H3d |
| Synonyms: | H3/b; H3FB; histone H3.1; H3 histone family, member B; histone 1, H3d; histone H3/b; histone cluster 1, H3d; histone cluster 1 H3 family member d |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcgtaccaagcagactgctcgcaagtccacgggtgggaaagcgccacgcaagcagctggccaccaaggctgctcgaaagagcgctccagccaccggcggcgtgaagaagccccaccgttaccggcccggcacggtggctctgcgcgagatccgccgctaccagaagtcgaccgagctgctgattcgcaaactgccattccagcgtctagtccgtgagatcgcgcaggacttcaagactgatctgcgttttcagagctcggcggtgatggcgctgcaggaggcctgcgaggcctacctggtggggctgtttgaggacaccaacctatgcgccattcacgccaagcgagtgactatcatgcccaaggacatccagcttgctcgccgcattcgtggggagagggcgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium binding protein 1 - tubulin folding cofactor C - aspartate beta-hydroxylase - SET domain, bifurcated 1 |