Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CGB-chorionic gonadotropin, beta polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CGB-chorionic gonadotropin, beta polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022796 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CGB |
| Origin species: | Human |
| Product name: | CGB-chorionic gonadotropin, beta polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC022796 |
| Gene id: | 1082 |
| Gene description: | chorionic gonadotropin, beta polypeptide |
| Synonyms: | CGB; CGB5; CGB7; CGB8; hCGB; choriogonadotropin subunit beta 3; CG-beta; choriogonadotropin subunit beta; chorionic gonadotrophin chain beta; chorionic gonadotropin beta 3 subunit; chorionic gonadotropin beta chain; chorionic gonadotropin beta subunit; chorionic gonadotropin chain beta; chorionic gonadotropin, beta polypeptide; chorionic gonadotropin beta subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctcccccgagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - immunoglobulin lambda variable 3-25 - chromosome 11 open reading frame 31 - chromosome 1 open reading frame 150 - chromosome 10 open reading frame 84 |