Cart 14 Product Products 1 828,86 € (empty)
-
1 x HIST1H2AJ-...113,40 € -
1 x CYTH2-cyto...121,50 € -
1 x ITGB3BP-in...113,40 € -
1 x ADH4-alcoh...121,50 € -
1 x GLIPR1-GLI...121,50 € -
1 x NUSAP1-nuc...121,50 € -
-
1 x SLC2A3-sol...121,50 € -
1 x PBX2-pre-B...121,50 € -
1 x FMO2-flavi...121,50 € -
1 x TMEM9B-TME...113,40 € -
-
1 x SPIN2B-spi...113,40 € -
1 x ZNRD1-zinc...113,40 €
No products
To be determined Shipping
1 828,86 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 828,86 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 828,86 €
Data sheet of LIPH-lipase, member H Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LIPH-lipase, member H Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064941 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIPH |
| Origin species: | Human |
| Product name: | LIPH-lipase, member H Gene |
| Size: | 2ug |
| Accessions: | BC064941 |
| Gene id: | 200879 |
| Gene description: | lipase, member H |
| Synonyms: | ARWH2; HYPT7; LAH2; LPDLR; PLA1B; mPA-PLA1; lipase member H; LPD lipase-related protein; lipase, member H; mPA-PLA1 alpha; membrane-associated phosphatidic acid-selective phospholipase A1-alpha; membrane-bound phosphatidic acid-selective phospholipase A1; phospholipase A(1); phospholipase A1 member B; lipase H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgagattctacttattcatcagtttgttgtgcttgtcaagatcagacgcagaagaaacatgtccttcattcaccaggctgagctttcacagtgcagtggttggtacgggactaaatgtgaggctgatgctctacacaaggaaaaacctgacctgcgcacaaaccatcaactcctcagcttttgggaacttgaatgtgaccaagaaaaccaccttcattgtccatggattcaggccaacaggctcccctcctgtttggatggatgacttagtaaagggtttgctctctgttgaagacatgaacgtagttgttgttgattggaatcgaggagctacaactttaatatatacccatgcctctagtaagaccagaaaagtagccatggtcttgaaggaatttattgaccagatgttggcagaaggagcttctcttgatgacatttacatgatcggagtaagtctaggagcccacatatctgggtttgttggagagatgtacgatggatggctggggagaattacaggcctcgaccctgcaggccctttattcaacgggaaacctcaccaagacagattagatcccagtgatgcgcagtttgttgatgtcatccattccgacactgatgcactgggctacaaggagccattaggaaacatagacttctacccaaatggaggattggatcaacctggctgccccaaaacaatattgggaggatttcagtattttaaatgtgaccaccagaggtctgtatacctgtacctgtcttccctgagagagagctgcaccatcactgcgtatccctgtgactcctaccaggattataggaatggcaagtgtgtcagctgcggcacgtcacaaaaagagtcctgtccccttctgggctattatgctgataattggaaagaccatctaagggggaaagatcctccaatgacgaaggcattctttgacacagctgaggagagcccattctgcatgtatcattactttgtggatattataacatggaacaagaatgtaagaagaggggacattaccatcaaattgagagacaaagctggaaacaccacagaatccaaaatcaatcatgaacccaccacatttcagaaatatcaccaagtgagtctacttgcaagatttaatcaagatctggataaagtggctgcaatttccttgatgttctctacaggatctctaataggcccaaggtacaagctcaggattctccgaatgaagttaaggtcccttgcccatccggagaggcctcagctgtgtcggtatgatcttgtcctgatggaaaacgttgaaacagtcttccaacctattctttgcccagagttgcagttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - brain protein I3 - Meis homeobox 2 - F-box protein 2 - forkhead box P2 |