No products
Prices are tax excluded
PTXBC032133
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032133 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM10 |
| Origin species: | Human |
| Product name: | TIMM10-translocase of inner mitochondrial membrane 10 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC032133 |
| Gene id: | 26519 |
| Gene description: | translocase of inner mitochondrial membrane 10 homolog (yeast) |
| Synonyms: | TIM10; TIM10A; TIMM10A; mitochondrial import inner membrane translocase subunit Tim10; translocase of inner mitochondrial membrane 10 homolog; translocase of inner mitochondrial membrane 10 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcctctcagggcccaacagctggctgcggagctggaggtggagatgatggccgatatgtacaacagaatgaccagtgcctgccaccggaagtgtgtgcctcctcactacaaggaagcagagctctccaagggcgagtctgtgtgcctggaccgatgtgtctctaagtacctggacatccatgagcggatgggcaaaaagttgacagagttgtctatgcaggatgaagagctgatgaagagggtgcagcagagctctgggcctgcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - mucosa associated lymphoid tissue lymphoma translocation gene 1 - serpin peptidase inhibitor, clade C (antithrombin), member 1 - N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) - small nuclear ribonucleoprotein polypeptide N pseudogene |