PTXBC032133
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC032133 |
Product type: | DNA & cDNA |
Ncbi symbol: | TIMM10 |
Origin species: | Human |
Product name: | TIMM10-translocase of inner mitochondrial membrane 10 homolog (yeast) Gene |
Size: | 2ug |
Accessions: | BC032133 |
Gene id: | 26519 |
Gene description: | translocase of inner mitochondrial membrane 10 homolog (yeast) |
Synonyms: | TIM10; TIM10A; TIMM10A; mitochondrial import inner membrane translocase subunit Tim10; translocase of inner mitochondrial membrane 10 homolog; translocase of inner mitochondrial membrane 10 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggatcctctcagggcccaacagctggctgcggagctggaggtggagatgatggccgatatgtacaacagaatgaccagtgcctgccaccggaagtgtgtgcctcctcactacaaggaagcagagctctccaagggcgagtctgtgtgcctggaccgatgtgtctctaagtacctggacatccatgagcggatgggcaaaaagttgacagagttgtctatgcaggatgaagagctgatgaagagggtgcagcagagctctgggcctgcatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - mucosa associated lymphoid tissue lymphoma translocation gene 1 - serpin peptidase inhibitor, clade C (antithrombin), member 1 - N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) - small nuclear ribonucleoprotein polypeptide N pseudogene |