Cart 4 Product Products 522,48 € (empty)
-
-
1 x PHTF2-puta...121,50 € -
-
No products
To be determined Shipping
522,48 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 522,48 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 522,48 €
Data sheet of RNF128-ring finger protein 128 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF128-ring finger protein 128 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063404 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF128 |
| Origin species: | Human |
| Product name: | RNF128-ring finger protein 128 Gene |
| Size: | 2ug |
| Accessions: | BC063404 |
| Gene id: | 79589 |
| Gene description: | ring finger protein 128 |
| Synonyms: | E3 ubiquitin-protein ligase RNF128; gene related to anergy in lymphocytes protein; ring finger protein 128, E3 ubiquitin protein ligase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggccgccgcctggggccggggtctcctgccgcggtggctgcggcttttccagattgctggcatggtgcttcctgctggccctgagtccgcaggcacccggttcccggggggctgaagcagtgtggaccgcgtacctcaacgtgtcctggcgggttccgcacacgggagtgaaccgtacggtgtgggagctgagcgaggagggcgtgtacggccaggactcgccgctggagcctgtggctggggtcctggtaccgcccgacgggcccggggcgcttaacgcctgtaacccgcacacgaatttcacggtgcccacggtttggggaagcaccgtgcaagtctcttggttggccctcatccaacgcggcgggggctgcaccttcgcagacaagatccatctggcttatgagagaggggcgtctggagccgtcatctttaacttccccgggacccgcaatgaggtcatccccatgtctcacccgggtgcagtagacattgttgcaatcatgatcggcaatctgaaaggcacaaaaattctgcaatctattcaaagaggcatacaagtgacaatggtcatagaagtagggaaaaaacatggcccttgggtgaatcactattcaatttttttcgtttctgtgtccttttttattattacggcggcaactgtgggctattttatcttttattctgctcgaaggctacggaatgcaagagctcaaagcaggaagcagaggcaattaaaggcagatgctaaaaaagctattggaaggcttcaactacgcacactgaaacaaggagacaaggaaattggccctgatggagatagttgtgctgtgtgcattgaattgtataaaccaaatgatttggtacgcatcttaacgtgcaaccatattttccataagacatgtgttgacccatggctgttagaacacaggacttgccccatgtgcaaatgtgacatactcaaagctttgggaattgaggtggatgttgaagatggatcagtgtctttacaagtccctgtatccaatgaaatatctaatagtgcctcctcccatgaagaggataatcgcagcgagaccgcatcatctggatatgcttcagtacagggaacagatgaaccgcctctggaggaacacgtgcagtcaacaaatgaaagtctacagctggtaaaccatgaagcaaattctgtggcagtggatgttattcctcatgttgacaacccaacctttgaagaagacgaaactcctaatcaagagactgctgttcgagaaattaaatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 384 - DEP domain containing 1 - zinc finger protein 253 - zinc finger protein 697 |