Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ICOSLG-inducible T-cell co-stimulator ligand Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ICOSLG-inducible T-cell co-stimulator ligand Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064637 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ICOSLG |
| Origin species: | Human |
| Product name: | ICOSLG-inducible T-cell co-stimulator ligand Gene |
| Size: | 2ug |
| Accessions: | BC064637 |
| Gene id: | 23308 |
| Gene description: | inducible T-cell co-stimulator ligand |
| Synonyms: | B7-H2; B7H2; B7RP-1; B7RP1; CD275; GL50; ICOS-L; ICOSL; LICOS; ICOS ligand; B7 homolog 2; B7 homologue 2; B7-like protein Gl50; B7-related protein 1; inducible T-cell co-stimulator ligand; transmembrane protein B7-H2 ICOS ligand; inducible T-cell costimulator ligand |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggctgggcagtcctggactgctcttcctgctcttcagcagccttcgagctgatactcaggagaaggaagtcagagcgatggtaggcagcgacgtggagctcagctgcgcttgccctgaaggaagccgttttgatttaaatgatgtttacgtatattggcaaaccagtgagtcgaaaaccgtggtgacctaccacatcccacagaacagctccttggaaaacgtggacagccgctaccggaaccgagccctgatgtcaccggccggcatgctgcggggcgacttctccctgcgcttgttcaacgtcaccccccaggacgagcagaagtttcactgcctggtgttgagccaatccctgggattccaggaggttttgagcgttgaggttacactgcatgtggcagcaaacttcagcgtgcccgtcgtcagcgccccccacagcccctcccaggatgagctcaccttcacgtgtacatccataaacggctaccccaggcccaacgtgtactggatcaataagacggacaacagcctgctggaccaggctctgcagaatgacaccgtcttcttgaacatgcggggcttgtatgacgtggtcagcgtgctgaggatcgcacggacccccagcgtgaacattggctgctgcatagagaacgtgcttctgcagcagaacctgactgtcggcagccagacaggaaatgacatcggagagagagacaagatcacagagaatccagtcagtaccggcgagaaaaacgcggccacgtggagcatcctggctgtcctgtgcctgcttgtggtcgtggcggtggccataggctgggtgtgcagggaccgatgcctccaacacagctatgcaggtgcctgggctgtgagtccggagacagagctcactggccacgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dyslexia susceptibility 1 candidate 1 - zinc finger, DHHC-type containing 13 - plasmalemma vesicle associated protein - chromosome 15 open reading frame 15 |