Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SCYL1BP1-SCY1-like 1 binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCYL1BP1-SCY1-like 1 binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064945 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCYL1BP1 |
| Origin species: | Human |
| Product name: | SCYL1BP1-SCY1-like 1 binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC064945 |
| Gene id: | 92344 |
| Gene description: | SCY1-like 1 binding protein 1 |
| Synonyms: | SCYL1BP1; NTKLBP1; RAB6-interacting golgin; N-terminal kinase-like-binding protein 1; NTKL-binding protein 1; SCY1-like 1-binding protein 1; SCYL1-BP1; SCYL1-binding protein 1; hNTKL-BP1; golgin, RAB6 interacting |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctgggcagcagtgttggcagtcgcggctgcgagatttgggcacttttgggggtgccggtggcccgggccgatggcgcaaggttgggcaggcttctctgaggaggaactgaggagactaaagcagactaaagatccatttgaaccacagcgacgtctccccgcgaagaaaagtcgacaacaacttcagcgagaaaaagcccttgtagagcaaagccaaaaacttgggcttcaagatggatcaacctcattacttccagagcagctgctttcagcaccaaaacagagagttaacgttcaaaaaccacctttttcttcccctactcttccgagtcatttcactctcacctcccccgttggtgatggacaaccacagggcattgaaagtcagccaaaggaactgggacttgagaattcccatgatggtcacaacaatgttgagattctacctccaaagccagattgcaaattggagaaaaagaaagtggaattgcaagaaaaatctcgttgggaagtcctccaacaagaacaacggctaatggaagagaaaaataaacgtaaaaaagctcttttggctaaagctattgcagaaagatctaaaagaactcaggcagagaccatgaaactaaagcggatccagaaggagttgcaggctttagatgacatggtgtcagctgacattggaattctcaggaaccggattgatcaggccagcttagactattcatacgctcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chloride intracellular channel 5 - tetratricopeptide repeat domain 5 - hypothetical LOC100126583 - retinoblastoma binding protein 5 |