Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ASRGL1-asparaginase like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASRGL1-asparaginase like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064963 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASRGL1 |
| Origin species: | Human |
| Product name: | ASRGL1-asparaginase like 1 Gene |
| Size: | 2ug |
| Accessions: | BC064963 |
| Gene id: | 80150 |
| Gene description: | asparaginase like 1 |
| Synonyms: | ALP; ALP1; CRASH; isoaspartyl peptidase/L-asparaginase; L-asparaginase; L-asparagine amidohydrolase; asparaginase-like 1 protein; asparaginase-like protein 1; beta-aspartyl-peptidase; isoaspartyl dipeptidase; testis secretory sperm-binding protein Li 242mP; asparaginase like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggttccagagattcctggagaaaaactggtgacagagagaaacaaaaagcgcctggaaaaagagaagcatgaaaaaggtgctcagaaaacagattgtcaaaaaaacttgggaaccgtgggtgctgttgccttggactgcaaagggaatgtagcctacgcaacctccacaggcggtatcgttaataaaatggtcggccgcgttggggactcaccgtgtctaggagctggaggttatgccgacaatgacatcggagccgtctcaaccacagggcatggggaaagcatcctgaaggtgaacctggctagactcaccctgttccacatagaacaaggaaagacggtagaagaggctgcggacctatcgttgggttatatgaagtcaagggttaaaggtttaggtggcctcatcgtggttagcaaaacaggagactgggtggcaaagtggacctccacctccatgccctgggcagccgccaaggacggcaagctgcacttcggaattgatcctgacgatactactatcaccgaccttccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kinesin light chain 3 - nei like 2 (E. coli) - centromere protein L - zinc finger protein 3 |