PTXBC066364
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIN3A |
| Origin species: | Human |
| Product name: | SIN3A-SIN3 homolog A, transcription regulator (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC066364 |
| Gene id: | 25942 |
| Gene description: | SIN3 homolog A, transcription regulator (yeast) |
| Synonyms: | transcriptional regulator, SIN3A; transcriptional corepressor Sin3a; transcriptional co-repressor Sin3A; histone deacetylase complex subunit Sin3a; paired amphipathic helix protein Sin3a; WITKOS; SIN3 homolog A, transcription regulator; SIN3 transcription regulator homolog A; SIN3 transcription regulator family member A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcggcgtttggatgaccaggagtcaccggtgtatgcagcccagcagcgtcggatccctggcagcacagaggcttttcctcaccagcaccgggtgcttgcccctgcccctcctgtgtatgaagcagtgtctgagaccatgcagtcagctacgggaattcagtactctgtaacacccagctaccaggtttcagccatgccacagagctccggcagtcatgggcccgctatagcagcagttcatagcagccatcatcacccaacagcggtgcagccccacggaggccaggtggtccagagtcatgctcatccagccccaccagttgcaccagtgcagggacagcagcaatttcagaggctgaaggtggtattcagctctttttcttgggtcaaaaaatttatctttagcaggaaatactggttgcagcttgttggttgtggtggtacaacttctaacctgagatactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 173, member B - signal recognition particle receptor, B subunit - PI-3-kinase-related kinase SMG-1 pseudogene - alpha- and gamma-adaptin-binding protein p34 |