Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BCL10-B-cell CLL/lymphoma 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCL10-B-cell CLL/lymphoma 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053617 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCL10 |
| Origin species: | Human |
| Product name: | BCL10-B-cell CLL/lymphoma 10 Gene |
| Size: | 2ug |
| Accessions: | BC053617 |
| Gene id: | 8915 |
| Gene description: | B-cell CLL/lymphoma 10 |
| Synonyms: | CARMEN; CIPER; CLAP; IMD37; c-E10; mE10; B-cell lymphoma/leukemia 10; CARD containing molecule enhancing NF-kB; CARD-containing apoptotic signaling protein; CARD-containing molecule enhancing NF-kappa-B; CARD-containing proapoptotic protein; CED-3/ICH-1 prodomain homologous E10-like regulator; cCARMEN; caspase-recruiting domain-containing protein; cellular homolog of vCARMEN; cellular-E10; hCLAP; mammalian CARD-containing adapter molecule E10; B-cell CLL/lymphoma 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccaccgcaccgtccctcaccgaggaggacctcactgaagtgaagaaggacgccttagaaaatttacgtgtatacctgtgtgagaaaatcatagctgagagacattttgatcatctacgtgcaaaaaaaatactcagtagagaagacactgaagaaatttcttgtcgaacatcaagtagaaaaagggctggaaaattgttagactacttacaggaaaacccaaaaggtctggacacccttgttgaatctattcggcgagaaaaaacacagaacttcctgatacagaagattacagatgaagtgctgaaacttagaaatataaaactagaacatctgaaaggactaaaatgtagcagttgtgaaccttttccagatggagccacgaacaacctctccagatcaaattcagatgagagtaatttctctgaaaaactgagggcatccactgtcatgtaccatccagaaggagaatccagcacgacgccctttttttctactaattcttctctgaatttgcctgttctagaagtaggcagaactgaaaataccatcttctcttcaactacacttcccagacctggggacccaggggctcctcctttgccaccagatctacagttagaagaagaaggaacttgtgcaaactctagtgagatgtttcttcccttaagatcacgtactgtttcacgacaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - IKK interacting protein - lactate dehydrogenase C - zinc finger protein 83 - olfactomedin-like 2A |