PTXBC063409
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063409 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NIP30 |
| Origin species: | Human |
| Product name: | NIP30-NEFA-interacting nuclear protein NIP30 Gene |
| Size: | 2ug |
| Accessions: | BC063409 |
| Gene id: | 80011 |
| Gene description: | NEFA-interacting nuclear protein NIP30 |
| Synonyms: | NEFA-interacting nuclear protein NIP30; NIP30; C16orf94; CDA018; CDA10; protein FAM192A; family with sequence similarity 192 member A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggaggggatgatggtaaccttattatcaaaaagaggtttgtgtctgaggcagaactagatgaacggcgcaaaaggaggcaagaagaatgggagaaagttcgaaaacctgaagatccagaagaatgtccagaggaggtttatgaccctcgatctctatatgaaaggctacaggaacagaaggacaggaagcagcaggagtacgaggaacagttcaaattcaaaaacatgtttgacccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 122C - chromosome 19 open reading frame 12 - B-cell receptor-associated protein 31 - chromosome 15 open reading frame 38 |