Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJC24-DnaJ (Hsp40) homolog, subfamily C, member 24 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC24-DnaJ (Hsp40) homolog, subfamily C, member 24 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063804 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC24 |
| Origin species: | Human |
| Product name: | DNAJC24-DnaJ (Hsp40) homolog, subfamily C, member 24 Gene |
| Size: | 2ug |
| Accessions: | BC063804 |
| Gene id: | 120526 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 24 |
| Synonyms: | DPH4; JJJ3; ZCSL3; dnaJ homolog subfamily C member 24; 1700030A21Rik; CSL-type zinc finger-containing protein 3; DPH4 homolog (JJJ3, S. cerevisiae); DPH4, JJJ3 homolog; DnaJ (Hsp40) homolog, subfamily C, member 24; diphthamide biosynthesis protein 4; zinc finger, CSL domain containing 3; zinc finger, CSL-type containing 3; DnaJ heat shock protein family (Hsp40) member C24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggttgagcagatgccaaaaaaggattggtacagcatcctgggagcagacccatctgcaaatatatcagacctaaaacaaaaatatcaaaaactcatattaatgtatcatccagataaacaaagtacagatgtaccagcaggaacagtggaggaatgtgtacagaagttcatcgaaattgatcaagcatggaaaattctaggaaatgaagagacaaaaagagagtatgacctgcagcggtgtgaagatgatctaagaaatgtaggaccagtagatgctcaagtatatcttgaagaaatgtcttggaatgaaggtgatcactctttttatctgagttgcagatgtggtggaaaatacagtgtttccaaggatgaagcggaagaagttagcctgatttcttgtgatacatgttcactaattatagaactccttcattataactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HSPB (heat shock 27kDa) associated protein 1 - phytanoyl-CoA dioxygenase domain containing 1 - DnaJ (Hsp40) homolog, subfamily B, member 12 - matrix metallopeptidase 14 (membrane-inserted) |