Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATP9B-ATPase, class II, type 9B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP9B-ATPase, class II, type 9B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053561 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP9B |
| Origin species: | Human |
| Product name: | ATP9B-ATPase, class II, type 9B Gene |
| Size: | 2ug |
| Accessions: | BC053561 |
| Gene id: | 374868 |
| Gene description: | ATPase, class II, type 9B |
| Synonyms: | ATPASEP; ATPIIB; HUSSY-20; NEO1L; hMMR1; ATPase type IV, phospholipid transporting (P-type); ATPase, class II, type 9B; macrophage MHC receptor 1; ATPase phospholipid transporting 9B (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccactaatgatgtctgaagaaggctttgagaatgaggaaagtgattaccacaccttaccacgagccaggataatgcaaaggaaaagaggactggagtggtttgtctgtgatggctggaagttcctctgtaccagttgctgtggttggctgataaatatttgtcgaagaaagaaagagctgaaagctcgcacagtatggcttggatgtcctgaaaagtgtgaagaaaaacatcccaggaattctataaaaaatcaaaaatacaatgtgtttacctttatacctggggttttgtatgaacaattcaagtttttcttgaatctctattttctagtaatatcctgctcacagtttgtaccagcattgaaaataggctatctctacacctactgggctcctctgatgacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SH2 domain containing 1B - transmembrane protein 60 - tropomodulin 2 (neuronal) - transmembrane protein 53 |