HDAC8-histone deacetylase 8 Gene View larger

HDAC8-histone deacetylase 8 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDAC8-histone deacetylase 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HDAC8-histone deacetylase 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050433
Product type: DNA & cDNA
Ncbi symbol: HDAC8
Origin species: Human
Product name: HDAC8-histone deacetylase 8 Gene
Size: 2ug
Accessions: BC050433
Gene id: 55869
Gene description: histone deacetylase 8
Synonyms: CDA07; CDLS5; HD8; HDACL1; MRXS6; RPD3; WTS; histone deacetylase 8; histone deacetylase-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagccggaggaaccggcggacagtgggcagtcgctggtcccggtttatatctatagtcccgagtatgtcagtatgtgtgactccccggccaagatccccaaacgggccagtatggtgcattctttgattgaagcatatgcactgcataagcaaatgaggatagttaagcctaaagtggcctccatggaggagatggccaccttccacactgatgcttatctgcagcatctccagaaggtcagccaagagggcgatgatgatcatccggactccatagaatatgggctaggttatgactgcccagccactgaagggatatttgactatgcagcagctataggaggggctacgatcacagctgcccaatgcctgattgacggaatgtgcaaagtagcaattaactggtctggagggtggcatcatgcaaagaaagatgaagcatctggtttttgttatctcaatgatgctgtcctgggaatattacgattgcgacggaaatttgagcgtattctctacgtggatttggatctgcaccatggagatggtgtagaagacgcattcagtttcacctccaaagtcatgaccgtgtccctgcacaaattctccccaggatttttcccaggaacaggtgacgtgtctgatgttggcctagggaagggacggtactacagtgtaaatgtgcccattcaggatggcatacaagatgaaaaatattaccagatctgtgaaagtgtactaaaggaagtataccaagcctttaatcccaaagcagtggtcttacagctgggagctgacacaatagctggggatcccatgtgctcctttaacatgactccagtgggaattggcaagtgtcttaagtacatccttcaatggcagttggcaacactcattttgggaggaggaggctataaccttgccaacacggctcgatgctggacatacttgaccggggtcatcctagggaaaacactatcctctgagatcccagatcatgagtttttcacagcatatggtcctgattatgtgctggaaatcacgccaagctgccggccagaccgcaatgagccccaccgaatccaacaaatcctcaactacatcaaagggaatctgaagcatgtggtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RD RNA binding protein
- EH-domain containing 4
- angiopoietin-like 1
- ribosomal protein L12

Buy HDAC8-histone deacetylase 8 Gene now

Add to cart