KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene View larger

KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC048810
Product type: DNA & cDNA
Ncbi symbol: KTELC1
Origin species: Human
Product name: KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene
Size: 2ug
Accessions: BC048810
Gene id: 56983
Gene description: KTEL (Lys-Tyr-Glu-Leu) containing 1
Synonyms: KTELC1; C3orf9; CLP46; KDELCL1; LGMD2Z; MDS010; MDSRP; Rumi; protein O-glucosyltransferase 1; 9630046K23Rik; CAP10-like 46 kDa protein; KDELC family like 1; KTEL (Lys-Tyr-Glu-Leu) containing 1; KTEL motif-containing protein 1; O-glucosyltransferase Rumi homolog; hRumi; myelodysplastic syndromes relative protein; protein O-xylosyltransferase; x 010 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtggtgggctagctcgccgcttcggctctggctgctgttgttcctcctgccctcagcgcagggccgccagaaggagtcaggttcaaaatggaaagtatttattgaccaaattaacaggtctttggagaattacgaaccatgttcaagtcaaaactgcagctgctaccatggtgtcatagaagaggatctaactcctttccgaggaggcatctccaggaagatgatggcagaggtagtcagacggaagctagggacccactatcagatcactaagaacagactgtaccgggaaaatgactgcatgttcccctcaaggtgtagtggtgttgagcactttattttggaagtgatcgggcgtctccctgacatggagatggtgatcaatgtacgagattatcctcaggttcctaaatggatggagcctgccatcccagtcttctccttcagtaagacatcagagtaccatgatatcatgtatcctgcttggacattttgggaagggggacctgctgtttggccaatttatcctacaggtcttggacggtgggacctcttcagagaagatctggtaaggtcagcagcacagtggccatggaaaaagaaaaactctacagcatatttccgaggatcaaggacaagtccagaacgagatcctctcattcttctgtctcggaaaaacccaaaacttgttgatgcagaatacaccaaaaaccaggcctggaaatctatgaaagataccttaggaaagccagctgctaaggatgtccatcttgtggatcactgcaaatacaagtatctgtttaattttcgaggcgtagctgcaagtttccggtttaaacacctcttcctgtgtggctcacttgttttccatgttggtgatgagtggctagaattcttctatccacagctgaagccatgggttcactatatcccagtcaaaacagatctctccaatgtccaagagctgttacaatttgtaaaagcaaatgatgatgtagctcaagagattgctgaaaggggaagccagtttattaggaaccatttgcagatggatgacatcacctgttactgggagaacctcttgagtgaatactctaaattcctgtcttataatgtaacgagaaggaaaggttatgatcaaattattcccaaaatgttgaaaactgaactatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 35
- chromosome 2 open reading frame 62
- archaelysin family metallopeptidase 2
- hect domain and RLD 2 pseudogene

Buy KTELC1-KTEL (Lys-Tyr-Glu-Leu) containing 1 Gene now

Add to cart