Login to display prices
Login to display prices
RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene View larger

RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene

PTXBC051820

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene

Proteogenix catalog: PTXBC051820
Ncbi symbol: RAB3IL1
Product name: RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene
Size: 2ug
Accessions: BC051820
Gene id: 5866
Gene description: RAB3A interacting protein (rabin3)-like 1
Synonyms: guanine nucleotide exchange factor for Rab-3A; RAB3A interacting protein (rabin3)-like 1; rab3A-interacting-like protein 1; rabin3-like 1; RAB3A interacting protein like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcttctgaggagcacgctgggtgccccgcccgagggacatgtcccgtgttcctggccatgagtgcagggactgtccgctacgccccatcaggcctgtgccctgtacttgaggggaacttgagagaagagccctggggcacagacagcccaccccagccagaccagggcctcccgccgccccttgcagctgtcccggtcccctggaagagcacggacccctgccaaggccacagggagtccccaggagccctggtggagacctctgcaggggaggaggcccaaggccaggagggccccgcagccgcccagctggacgtgttgcgcctgcgcagctcttccatggagatccgagagaagggctccgagttcctgaaggaggagctgcacagagcgcagaaggagctgaagctaaaggacgaggaatgtgagcggctgtccaaggtgcgggagcagctagaacaggagctggaagagctgacggccagcctgtttgaggaagctcacaagatggttcgagaagccaacatgaagcaggcggcatcagaaaagcagctgaaggaggctcggggcaaggtggacacaatcctgtttgcagagttccaggcctggagggaatcccccaccctggacaagacctgccccttcctggaaagggtgtaccgagaggacgtgggcccctgcctggacttcacaatgcaggagctctcggtgctggtacgggccgccgtggaggacaacacgctcaccattgagccggtggcttcgcagacgctgcccacagtgaaggtggccgaggttgactgtagcagcaccaacacatgtgccctgagcgggctgacccgcacctgccgccaccgaatccggctcggggactccaaaagccattactacatctcgccatcttcccgggccaggatcaccgcagtgtgcaacttcttcacctacatccgctacatccagcaaggcctggtgcggcaggacgcagagcccatgttctgggagatcatgaggttgcggaaggagatgtcactggccaagctcggcttcttcccccaggaggcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: