RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene View larger

RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051820
Product type: DNA & cDNA
Ncbi symbol: RAB3IL1
Origin species: Human
Product name: RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene
Size: 2ug
Accessions: BC051820
Gene id: 5866
Gene description: RAB3A interacting protein (rabin3)-like 1
Synonyms: guanine nucleotide exchange factor for Rab-3A; RAB3A interacting protein (rabin3)-like 1; rab3A-interacting-like protein 1; rabin3-like 1; RAB3A interacting protein like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcttctgaggagcacgctgggtgccccgcccgagggacatgtcccgtgttcctggccatgagtgcagggactgtccgctacgccccatcaggcctgtgccctgtacttgaggggaacttgagagaagagccctggggcacagacagcccaccccagccagaccagggcctcccgccgccccttgcagctgtcccggtcccctggaagagcacggacccctgccaaggccacagggagtccccaggagccctggtggagacctctgcaggggaggaggcccaaggccaggagggccccgcagccgcccagctggacgtgttgcgcctgcgcagctcttccatggagatccgagagaagggctccgagttcctgaaggaggagctgcacagagcgcagaaggagctgaagctaaaggacgaggaatgtgagcggctgtccaaggtgcgggagcagctagaacaggagctggaagagctgacggccagcctgtttgaggaagctcacaagatggttcgagaagccaacatgaagcaggcggcatcagaaaagcagctgaaggaggctcggggcaaggtggacacaatcctgtttgcagagttccaggcctggagggaatcccccaccctggacaagacctgccccttcctggaaagggtgtaccgagaggacgtgggcccctgcctggacttcacaatgcaggagctctcggtgctggtacgggccgccgtggaggacaacacgctcaccattgagccggtggcttcgcagacgctgcccacagtgaaggtggccgaggttgactgtagcagcaccaacacatgtgccctgagcgggctgacccgcacctgccgccaccgaatccggctcggggactccaaaagccattactacatctcgccatcttcccgggccaggatcaccgcagtgtgcaacttcttcacctacatccgctacatccagcaaggcctggtgcggcaggacgcagagcccatgttctgggagatcatgaggttgcggaaggagatgtcactggccaagctcggcttcttcccccaggaggcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - suppressor of Ty 3 homolog (S. cerevisiae)
- DALR anticodon binding domain containing 3
- zinc finger and SCAN domain containing 21
- UEV and lactate/malate dehyrogenase domains

Buy RAB3IL1-RAB3A interacting protein (rabin3)-like 1 Gene now

Add to cart