C20orf103-chromosome 20 open reading frame 103 Gene View larger

C20orf103-chromosome 20 open reading frame 103 Gene

PTXBC050727

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf103-chromosome 20 open reading frame 103 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf103-chromosome 20 open reading frame 103 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050727
Product type: DNA & cDNA
Ncbi symbol: C20orf103
Origin species: Human
Product name: C20orf103-chromosome 20 open reading frame 103 Gene
Size: 2ug
Accessions: BC050727
Gene id: 24141
Gene description: chromosome 20 open reading frame 103
Synonyms: LAMP family protein C20orf103; C20orf103; BAD-LAMP; BADLAMP; LAMP-5; UNC-46; lysosome-associated membrane glycoprotein 5; brain and dendritic cell-associated LAMP; brain-associated LAMP-like protein; lysosome-associated membrane protein 5; lysosomal associated membrane protein family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatctccaaggaagaggggtccccagcatcgacagacttcgagttctcctgatgttgttccatacaatggctcaaatcatggcagaacaagaagtggaaaatctctcaggcctttccactaaccctgaaaaagatatatttgtggtgcgggaaaatgggacgacgtgtctcatggcagagtttgcagccaaatttattgtaccttatgatgtgtgggccagcaactacgtagatctgatcacagaacaggccgatatcgcattgacccggggagctgaggtgaagggccgctgtggccacagccagtcggagctgcaagtgttctgggtggatcgcgcatatgcactcaaaatgctctttgtaaaggaaagccacaacatgtccaagggacctgaggcgacttggaggctgagcaaagtgcagtttgtctacgactcctcggagaaaacccacttcaaagacgcagtcagtgctgggaagcacacagccaactcgcaccacctctctgccttggtcacccccgctgggaagtcctatgagtgtcaagctcaacaaaccatttcactggcctctagtgatccgcagaagacggtcaccatgatcctgtctgcggtccacatccaaccttttgacattatctcagattttgtcttcagtgaagagcataaatgcccagtggatgagcgggagcaactggaagaaaccttgcccctgattttggggctcatcttgggcctcgtcatcatggtaacactcgcgatttaccacgtccaccacaaaatgactgccaaccaggtgcagatccctcgggacagatcccagtataagcacatgggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, CCHC domain containing 11
- WAS protein family homolog 3 pseudogene
- adhesion molecule with Ig-like domain 1
- methyltransferase 10 domain containing

Buy C20orf103-chromosome 20 open reading frame 103 Gene now

Add to cart