Login to display prices
Login to display prices
CGGBP1-CGG triplet repeat binding protein 1 Gene View larger

CGGBP1-CGG triplet repeat binding protein 1 Gene

PTXBC052980

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CGGBP1-CGG triplet repeat binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CGGBP1-CGG triplet repeat binding protein 1 Gene

Proteogenix catalog: PTXBC052980
Ncbi symbol: CGGBP1
Product name: CGGBP1-CGG triplet repeat binding protein 1 Gene
Size: 2ug
Accessions: BC052980
Gene id: 8545
Gene description: CGG triplet repeat binding protein 1
Synonyms: CGGBP; p20-CGGBP; CGG triplet repeat-binding protein 1; 20 kDa CGG-binding protein; CGG-binding protein 1; p20-CGG binding protein; p20-CGGBP DNA-binding protein; CGG triplet repeat binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgatttgtagtaacagcaccacctgctcgaaaccgttctaagactgctttgtatgtgactcccctggatcgagtcactgagtttggaggtgagctgcatgaagatggaggaaaactcttctgcacttcttgcaatgtggttctgaatcatgttcgcaagtctgccattagtgaccacctcaagtcaaagactcataccaagaggaaggcagaatttgaagagcagaatgtgagaaagaagcagaggcccctaactgcatctcttcagtgcaacagtactgcgcaaacagagaaagtcagtgttatccaggactttgtgaaaatgtgcctggaagccaacatcccacttgagaaggctgatcacccagcagtccgtgctttcctatctcgccatgtgaagaatggaggctccatacctaagtcagaccagctacggagggcatatcttcctgatggatatgagaatgagaatcaactcctcaactcacaagattgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: