RASL12-RAS-like, family 12 Gene View larger

RASL12-RAS-like, family 12 Gene

PTXBC053734

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RASL12-RAS-like, family 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RASL12-RAS-like, family 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC053734
Product type: DNA & cDNA
Ncbi symbol: RASL12
Origin species: Human
Product name: RASL12-RAS-like, family 12 Gene
Size: 2ug
Accessions: BC053734
Gene id: 51285
Gene description: RAS-like, family 12
Synonyms: RIS; ras-like protein family member 12; Ras family member Ris; ras-like protein Ris; RAS like family 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctcggtgtttggaaaaccccgcgcgggcagcgggcctcagagcgcgcccctcgaggtcaacctggccatcctggggcgccgcggggctggcaagtctgccctgaccgtgaagtttctgaccaagaggtttatcagtgaatatgaccccaacttggaggacacctacagctccgaggagactgtggaccaccagcctgtccacctgagggtcatggacactgcagacctggacacccccaggaactgcgagcgctacctgaactgggcccatgccttcctggtggtgtacagcgtcgacagccgccagagctttgatagcagcagcagctacctggagctgcttgccttgcacgcgaaggagacacagcgcagcatccctgccctgctgctgggcaacaagctggacatggctcagtacaggcaagtcaccaaggcagagggtgtggctttggcaggcaggtttgggtgcctgtttttcgaggtctctgcctgtctggactttgagcacgtgcagcatgtcttccacgaggcagtgcgagaggcacggcgggagctggagaagagccccctgacccggcccctcttcatctccgaggagagggccctgccccaccaggccccgctcactgcgcggcatgggctggccagctgcaccttcaacacgctctccaccatcaacctgaaggagatgcccactgtggcccaggccaagctggtcaccgtgaagtcatcccgggcccagagcaagcgcaaggcgcctaccctgactctcctgaagggcttcaagatcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SMAD family member 3
- bridging integrator 2
- early B-cell factor 4
- oncostatin M receptor

Buy RASL12-RAS-like, family 12 Gene now

Add to cart