IQCF2-IQ motif containing F2 Gene View larger

IQCF2-IQ motif containing F2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IQCF2-IQ motif containing F2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IQCF2-IQ motif containing F2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040047
Product type: DNA & cDNA
Ncbi symbol: IQCF2
Origin species: Human
Product name: IQCF2-IQ motif containing F2 Gene
Size: 2ug
Accessions: BC040047
Gene id: 389123
Gene description: IQ motif containing F2
Synonyms: IQ domain-containing protein F2; IQ motif containing F2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggttcgattttgtaccaaaggcaatttaattttggttataattgaggatgttgaagaaagcattgaatggaagacattgcagaagaagaaacagcagaaaatcaaggaaaaacttagaataagaacaaaagcagctgtaaagatccaggcctggtggcggggcaccctggtgcgcaggacactgctgcatgcagccctcagggcctggataattcagtgctggtggcggatgacgctgtcgagggtgctggagaagaaacggcaggcagctctgatcgcctacgcaaccagagagagggcagtgatcaagctccagtctttggtccgtatgtggcgtgtccgctggcgatactgccaggtgctcaatgccatctacatcatccagggccactggcaatgccacaactgccagacctgcgctctcctccagggccactgtgtggtcacagccactcacctgcagttccacattgagatcatcaactcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MON1 homolog A (yeast)
- Kruppel-like factor 17
- lactate dehydrogenase D
- zinc finger protein 26

Buy IQCF2-IQ motif containing F2 Gene now

Add to cart