Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of WFDC2-WAP four-disulfide core domain 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WFDC2-WAP four-disulfide core domain 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046106 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WFDC2 |
| Origin species: | Human |
| Product name: | WFDC2-WAP four-disulfide core domain 2 Gene |
| Size: | 2ug |
| Accessions: | BC046106 |
| Gene id: | 10406 |
| Gene description: | WAP four-disulfide core domain 2 |
| Synonyms: | EDDM4; HE4; WAP5; dJ461P17.6; WAP four-disulfide core domain protein 2; WAP domain containing protein HE4-V4; epididymal protein 4; epididymal secretory protein E4; epididymis-specific, whey-acidic protein type, four-disulfide core; major epididymis-specific protein E4; WAP four-disulfide core domain 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgcttgtcgcctaggcccgctagccgccgccctcctcctcagcctgctgctgttcggcttcaccctagtctcaggcacaggagcagagaagactggcgtgtgccccgagctccaggctgaccagaactgcacgcaagagtgcgtctcggacagcgaatgcgccgacaacctcaagtgctgcagcgcgggctgtgccaccttctgctctctgcccaatgataaggagggttcctgcccccaggtgaacattaactttccccagctcggcctctgtcgggaccagtgccaggtggacagccagtgtcctggccagatgaaatgctgccgcaatggctgtgggaaggtgtcctgtgtcactcccaatttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cornichon homolog 2 (Drosophila) - glutathione peroxidase 3 (plasma) - peroxisomal biogenesis factor 26 - dual specificity phosphatase 16 |