Cart 20 Product Products 3 817,09 € (empty)
-
1 x DEFB1-defe...113,40 € -
-
1 x Goat...199,00 € -
1 x PPAP2B-pho...121,50 € -
1 x HSDL1-hydr...121,50 € -
1 x ACTR2-ARP2...121,50 € -
1 x PRPF40A-PR...113,40 € -
1 x GMPR2-guan...121,50 € -
1 x Chicken...311,00 € -
1 x DNAJA4-Dna...121,50 € -
1 x CKS2-CDC28...113,40 € -
1 x Goat...1 189,00 € -
1 x Goat...201,00 € -
-
1 x DLK1-delta...121,50 € -
1 x DVL1-dishe...121,50 € -
1 x AVL9-AVL9...121,50 € -
1 x POLB-polym...121,50 € -
-
1 x BUB3-buddi...121,50 €
No products
To be determined Shipping
3 817,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 817,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 817,09 €
Data sheet of GPR172B-G protein-coupled receptor 172B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR172B-G protein-coupled receptor 172B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060810 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR172B |
| Origin species: | Human |
| Product name: | GPR172B-G protein-coupled receptor 172B Gene |
| Size: | 2ug |
| Accessions: | BC060810 |
| Gene id: | 55065 |
| Gene description: | G protein-coupled receptor 172B |
| Synonyms: | GPR172B; GPCR42; PAR2; RBFVD; RFT1; RFVT1; hRFT1; solute carrier family 52, riboflavin transporter, member 1; G protein-coupled receptor 172B; G-protein coupled receptor GPCR42; PERV-A receptor 2; porcine endogenous retrovirus A receptor 2; solute carrier family 52 (riboflavin transporter), member 1; solute carrier family 52 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcacccacgctgggccgtctggtgctgacccacctgctggtggccctttttggcatgggctcctgggctgctgtgaacgggatctgggtggagctgcctgtggtggtaaaagaccttccagagggttggagcctcccctcatacctctctgtggttgtggcgctgggaaacctgggtctgctggtggtgaccctgtggaggcggctggccccgggcaagggcgagcaggtccccatccaggtggtacaggtgctgagtgtagtgggcacagccctgctggcccctctgtggcaccacgtggccccagtggcagggcagctccactctgtggccttcctaactctggccttggtgttggcaatggcctgttgtacctctaatgtcactttcctgcccttcctgagccacctgccacctcctttcttacggtctttcttcctgggtcagggtctcagtgccctactcccctgtgtgctggccctagtgcaaggtgtgggccgcctcgagtgcccaccagcgcccaccaatggcacctctgggcctcccctcgacttccctgagcgttttcctgccagcaccttcttctgggcactgactgcccttctggtcacttcagctgccgccttccggggtctcctgttgctgttgccatcactaccctctgtaaccacagggggctcagggcctgaacttcaactgggatccccaggagcagaggaggaagagaaggaggaagaagaggctttgccattgcaggagccaccgagccaggcagcaggcaccatccctggcccagaccctgaggtccatcagctgttctcagcccatggtgccttcctgctgggcctgatggccttcaccagtgccgtgaccaatggcgtgctgccttctgtgcagagcttttcctgtttgccctatgggcgcctggcctaccacctggctgtggtgctgggcagtgccgccaacccccttgcctgcttcctggccatgggcgtgctgtgcaggtccctggcagggctggttggtctttctctgctgggcatgctctttggggcctacctgatggcactggcaatcctgagcccctgcccacccctggtgggcaccactgcaggggtggtccttgtggtgctgtcgtgggtgctgtgtctgtgtgtgttctcatatgtgaaggtggctgcaagctccctgctgcatggtgggggtcggccggcattgctggcagctggtgtggccatccaagtgggctccctgcttggtgccggtgccatgttccctcccaccagcatctaccacgtgtttcaaagcagaaaggactgtgtagacccctgtggcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eyes absent homolog 3 (Drosophila) - ribonucleoprotein, PTB-binding 1 - bladder cancer associated protein - coiled-coil domain containing 52 |