Cart 21 Product Products 3 089,14 € (empty)
-
-
-
1 x Donkey...225,00 € -
1 x SLC35A4-so...121,50 € -
1 x HLA-DQA1-m...113,40 € -
1 x CRYGD-crys...113,40 € -
-
1 x FLJ20628-h...121,50 € -
-
1 x GALT-galac...121,50 € -
-
-
-
1 x XAGE1A-X...113,40 € -
-
1 x HLA-DPA1-m...113,40 € -
1 x Goat...275,00 € -
-
1 x CCL19-chem...113,40 € -
-
No products
To be determined Shipping
3 089,14 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 089,14 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 089,14 €
Data sheet of ARHGAP25-Rho GTPase activating protein 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP25-Rho GTPase activating protein 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039591 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP25 |
| Origin species: | Human |
| Product name: | ARHGAP25-Rho GTPase activating protein 25 Gene |
| Size: | 2ug |
| Accessions: | BC039591 |
| Gene id: | 9938 |
| Gene description: | Rho GTPase activating protein 25 |
| Synonyms: | HEL-S-308; KAIA0053; rho GTPase-activating protein 25; epididymis secretory protein Li 308; rho-type GTPase-activating protein 25; Rho GTPase activating protein 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctcggtcagtcggcctgtctgttcctctctatagctcggtcaaggagtgtgatgactggcgagcagatggctgccttccatccatcgtccacccccaacccgctggagaggcccatcaagatgggctggctgaagaagcagaggtccatcgtgaagaactggcagcagaggtactttgtgctgagggcgcagcagctctactactacaaggatgaagaggacacgaagccccagggctgcatgtatctaccaggatgtacaatcaaggagatcgccacaaacccagaagaagctgggaagtttgtctttgaaatcattccagcctcatgggaccagaatcgcatgggacaggactcctatgtcctcatggccagctctcaggcggagatggaggagtgggttaaattcctcaggagagttgctggcacaccctgtggagcagtgtttggccagcgcttggatgagactgtggcctatgaacagaaattcggcccccatctggtgcccatcctggtggagaaatgtgcagagttcatcctggagcacggccggaatgaagagggcatcttccgtctgcctgggcaggacaacctggtgaagcagctgagagacgcttttgatgctggggagcggccctcctttgacagagacacagatgtgcacactgtggcttccctgttaaagctctacctccgagacctcccagagcccgtggttccctggagccagtacgaagggttcctgctctgtgggcagctcacgaatgcggatgaggcaaaggctcagcaggagttgatgaagcagctctccatccttcctcgtgacaactatagtctcctgagctacatctgcaggttcctacatgaaatacagctgaactgtgctgttaacaagatgagtgtggacaacctggctactgtgattggtgtgaatctcatcaggtcgaaggtcgaagaccctgccgtgatcatgagagggactcctcagatccaaagagtgatgactatgatgatcagagaccatgaagtcctcttccccaagtccaaggatatacccctgtcaccccctgcccagaaaaatgaccccaagaaagctccagtggcccgaagctctgtaggctgggatgccactgaagacctccgaatttctaggacagacagcttcagtagcatggtaaggtgcagagaaccttcctgcttccattgggttcttcctttagtccaggccatcccatgtaaggcctgctctcgggtggcaatttggggagttttaggtgatgcagtggcagtgggcgctgctgctacagactcatctgaacacaccttgaaagcctggcctctttccaaatctagtttctattggcatctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 88C - baculoviral IAP repeat-containing 3 - SRY (sex determining region Y)-box 5 - microfibrillar-associated protein 1 |