Cart 19 Product Products 7 247,96 € (empty)
No products
To be determined Shipping
7 247,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 247,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 247,96 €
View larger 
Data sheet of ARNT-aryl hydrocarbon receptor nuclear translocator Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARNT-aryl hydrocarbon receptor nuclear translocator Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060838 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARNT |
| Origin species: | Human |
| Product name: | ARNT-aryl hydrocarbon receptor nuclear translocator Gene |
| Size: | 2ug |
| Accessions: | BC060838 |
| Gene id: | 405 |
| Gene description: | aryl hydrocarbon receptor nuclear translocator |
| Synonyms: | HIF-1-beta; HIF-1beta; HIF1-beta; HIF1B; HIF1BETA; TANGO; bHLHe2; aryl hydrocarbon receptor nuclear translocator; class E basic helix-loop-helix protein 2; dioxin receptor, nuclear translocator; hypoxia-inducible factor 1, beta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcctctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaagcggcgaccagggctggattttgatgatgatggagaagggaacagtaaatttttgaggtgtgatgatgatcagatgtctaacgataaggagcggtttgccaggtcggatgatgagcagagctctgcggataaagagagacttgcaagggaaaatcacagtgaaattgaacggcggcgacggaacaagatgacagcctacatcacagaactgtcagatatggtacccacatgtagtgccctggctcgaaaaccagacaagctaaccatcttacgcatggcagtttctcacatgaagtccttgcggggaactggcaacacatccactgatggctcctataagccgtctttcctcactgatcaggaactgaaacatttgatcttggaggcagcagatggctttctgtttattgtctcatgtgagacaggcagggtggtgtatgtctctgactccgtgactcctgttttgaaccagcaacagtctgaatggtttggcagcacactctatgatcaggtgcacccagatgatgtggataaacttcgtgagcagctttccacttcagaaaatgccctgacagggcgtatcctggatctaaagactggaacagtgaaaaaggaaggtcagcagtcttccatgagaatgtgtatgggctcaaggagatcgtttatttgccgaatgaggtgtggcagtagctctgtggacccagtttctgtgaataggctgagctttgtgaggaacagatgcaggaatggacttggctctgtaaaggatggggaacctcacttcgtggtggtccactgcacaggctacatcaaggcctggcccccagcaggtgtttccctcccagatgatgacccagaggctggccagggaagcaagttttgcctagtggccattggcagattgcaggtaactagttctcccaactgtacagacatgagtaatgtttgtcaaccaacagagttaatctcccgacacaacattgagggtatcttcacttttgtggatcaccgctgtgtggctactgttggctaccagccacaggaactcttaggaaagaatattgtagaattctgtcatcctgaagaccagcagcttctaagagacagcttccaacaggaactctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane and coiled-coil domain family 1 - tubulin tyrosine ligase-like family, member 7 - poly (ADP-ribose) polymerase family, member 9 - family with sequence similarity 78, member A |