Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ARID3B-AT rich interactive domain 3B (BRIGHT-like) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARID3B-AT rich interactive domain 3B (BRIGHT-like) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060824 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARID3B |
| Origin species: | Human |
| Product name: | ARID3B-AT rich interactive domain 3B (BRIGHT-like) Gene |
| Size: | 2ug |
| Accessions: | BC060824 |
| Gene id: | 10620 |
| Gene description: | AT rich interactive domain 3B (BRIGHT-like) |
| Synonyms: | BDP; DRIL2; AT-rich interactive domain-containing protein 3B; ARID domain-containing protein 3B; AT rich interactive domain 3B (BRIGHT- like); bright and dead ringer protein; bright-like protein; AT-rich interaction domain 3B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccacttcagcagcagcagcagcagcagcagcaacaacagaagcagccacacctggctcctctgcagatggatgccagagagaagcagggccagcagatgagagaagcccagttcttgtatgcccaaaagctggtcacacagccgactctcctttccgccacagctgggagaccttctggcagcactcccttaggtcccttagccagagttccacccaccgcagcagtggcccaagtgtttgaacggggcaacatgaactcagagcctgaggaagaggacggaggtttggaagatgaggatggggatgatgaagttgcagaggtggctgagaaagaaacccaggctgcttcaaaatattttcatgtgcagaaagtagctcgccaagatcccagagtggcacccatgtccaatctacttccagcaccagggctcccaccacatggacaacaagctaaagaagaccataccaaagatgcttccaaggcctcaccttctgtctccacagcaggacagccgaactggaatctggatgagcagctcaagcagaatggtggtttggcctggagtgatgatgcagatggaggccggggaagagagatctctcgagattttgccaagctgtatgaactggacggtgatcctgaaaggaaagagttcctggatgacctcttcgtctttatgcagaagaggggtgagtgtgcatctactcatcattccaattcagggaatactgatagagtgcctactgtgtgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 2 - vitamin D (1,25- dihydroxyvitamin D3) receptor - mitochondrial translational release factor 1 - xenotropic and polytropic retrovirus receptor |