Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EIF2C3-eukaryotic translation initiation factor 2C, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF2C3-eukaryotic translation initiation factor 2C, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066888 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF2C3 |
| Origin species: | Human |
| Product name: | EIF2C3-eukaryotic translation initiation factor 2C, 3 Gene |
| Size: | 2ug |
| Accessions: | BC066888 |
| Gene id: | 192669 |
| Gene description: | eukaryotic translation initiation factor 2C, 3 |
| Synonyms: | EIF2C3; protein argonaute-3; argonaute 3; argonaute RISC catalytic component 3; eukaryotic translation initiation factor 2C, 3; hAgo3; argonaute 3, RISC catalytic component |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaatcggctccgcaggacccgctggggcccagcccctactcatggtgcccagaagacctggctatggcaccatgggcaaacccattaaactgctggctaactgttttcaagttgaaatcccaaagattgatgtctacctctatgaggtagatattaaaccagacaagtgtcctaggagagtgaacagggaggtggttgactcaatggttcagcattttaaagtaactatatttggagaccgtagaccagtttataatggaaaaagaagtctttacaccgccaatccacttcctgtggcaactacaggggtagatttagacgttactttacctggggaaggtggaaaagatcgacctttcaaggtgtcaatcaaatttgtctctcgggtgagttggcacctactgcatgaagtactgacaggacggaccttgcctgagccactggaattagacaagccaatcagcactaaccctgtccatgccgttgatgtggtgctacgacatctgccctccatgaaatacacacctgtggggcgttcatttttctccgctccagaaggatatgaccaccctctgggagggggcagggaagtgtggtttggattccatcagtctgttcggcctgccatgtggaaaatgatgcttaatatcgatgaaagagacctctggcagcagtgtggagaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 175, member A - purinergic receptor P2Y, G-protein coupled, 13 - family with sequence similarity 90, member A1 - nuclear receptor subfamily 1, group H, member 3 |