RHEB-Ras homolog enriched in brain Gene View larger

RHEB-Ras homolog enriched in brain Gene

PTXBC066307

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RHEB-Ras homolog enriched in brain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RHEB-Ras homolog enriched in brain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066307
Product type: DNA & cDNA
Ncbi symbol: RHEB
Origin species: Human
Product name: RHEB-Ras homolog enriched in brain Gene
Size: 2ug
Accessions: BC066307
Gene id: 6009
Gene description: Ras homolog enriched in brain
Synonyms: GTP-binding protein Rheb; RHEB2; Ras homolog enriched in brain 2; Ras homolog enriched in brain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgtagacacagccgggcaagatgaatattctatctttcctcagacatactccatagatattaatggctatattcttgtgtattttgttacatcaatcaaaagttttgaagtgattaaagttatccatggcaaattgttggatatggtggggaaagtacaaatacctattatgttggttgggaataagaaagacctgcatatggaaagggtgatcagttatgaagaagggaaagctttggcagaatcttggaatgcagcttttttggaatcttctgctaaagaaaatcagactgctgtggatgtttttcgaaggataattttggaggcagaaaaaatggacggggcagcttcacaaggcaagtcttcatgctcggtgatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - integral membrane protein 2A
- GDNF family receptor alpha 2
- integrator complex subunit 6
- unc-5 homolog C (C. elegans)

Reviews

Buy RHEB-Ras homolog enriched in brain Gene now

Add to cart