TMEM9B-TMEM9 domain family, member B Gene View larger

TMEM9B-TMEM9 domain family, member B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM9B-TMEM9 domain family, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM9B-TMEM9 domain family, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015884
Product type: DNA & cDNA
Ncbi symbol: TMEM9B
Origin species: Human
Product name: TMEM9B-TMEM9 domain family, member B Gene
Size: 2ug
Accessions: BC015884
Gene id: 56674
Gene description: TMEM9 domain family, member B
Synonyms: C11orf15; transmembrane protein 9B; TMEM9 domain family member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgtgcgggggcctgatgtagaagcatactgtctacgctgtgaatgcaaatatgaagaaagaagctctgtcacaatcaaggttaccattataatttatctctccattttgggccttctacttctgtacatggtatatcttactctggttgagcccatactgaagaggcgcctctttggacatgcacagttgatacagagtgatgatgatattggggatcaccagccttttgcaaatgcacacgatgtgctagcccgctcccgcagtcgagccaacgtgctgaacaaggtagaatatgcacagcagcgctggaagcttcaagtccaagagcagcgaaagtctgtctttgaccggcatgttgtcctcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TMEM9 domain family, member B
- parathyroid hormone 2 receptor
- grainyhead-like 3 (Drosophila)
- zinc finger family member 767

Buy TMEM9B-TMEM9 domain family, member B Gene now

Add to cart