Login to display prices
Login to display prices
TMEM9B-TMEM9 domain family, member B Gene View larger

TMEM9B-TMEM9 domain family, member B Gene

PTXBC015884

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM9B-TMEM9 domain family, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM9B-TMEM9 domain family, member B Gene

Proteogenix catalog: PTXBC015884
Ncbi symbol: TMEM9B
Product name: TMEM9B-TMEM9 domain family, member B Gene
Size: 2ug
Accessions: BC015884
Gene id: 56674
Gene description: TMEM9 domain family, member B
Synonyms: C11orf15; transmembrane protein 9B; TMEM9 domain family member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgtgcgggggcctgatgtagaagcatactgtctacgctgtgaatgcaaatatgaagaaagaagctctgtcacaatcaaggttaccattataatttatctctccattttgggccttctacttctgtacatggtatatcttactctggttgagcccatactgaagaggcgcctctttggacatgcacagttgatacagagtgatgatgatattggggatcaccagccttttgcaaatgcacacgatgtgctagcccgctcccgcagtcgagccaacgtgctgaacaaggtagaatatgcacagcagcgctggaagcttcaagtccaagagcagcgaaagtctgtctttgaccggcatgttgtcctcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: