Login to display prices
Login to display prices
RASL10B-RAS-like, family 10, member B Gene View larger

RASL10B-RAS-like, family 10, member B Gene

PTXBC041133

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RASL10B-RAS-like, family 10, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RASL10B-RAS-like, family 10, member B Gene

Proteogenix catalog: PTXBC041133
Ncbi symbol: RASL10B
Product name: RASL10B-RAS-like, family 10, member B Gene
Size: 2ug
Accessions: BC041133
Gene id: 91608
Gene description: RAS-like, family 10, member B
Synonyms: alternative protein RASL10B; RRP17; VTS58635; ras-like protein family member 10B; Ras-related protein 17; ras-like protein VTS58635; RAS like family 10 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctccacctaccgggtggccgtgctgggggcgcgaggtgtgggcaagagtgccatcgtgcgccagttcttgtacaacgagttcagcgaggtctgcgtccccaccaccgcccgccgcctttacctgcctgctgtcgtcatgaacggccacgtgcacgacctccagatcctcgactttccacccatcagcgccttccctgtcaatacgctccaggagtgggcagacacctgctgcaggggactccggagtgtccacgcctacatcctggtctacgacatctgctgctttgacagctttgagtacgtcaagaccatccgccagcagatcctggagacgagggtgatcggaacctcagagacgcccatcatcatcgtgggcaacaagcgggacctgcagcgcggacgcgtgatcccgcgctggaacgtgtcgcacctggtacgcaagacctggaagtgcggctacgtggaatgctcggccaagtacaactggcacatcctgctgctcttcagcgagctgctcaagagcgtcggctgcgcccgttgcaagcacgtgcacgctgccctgcgcttccagggcgcgctgcgccgcaaccgctgcgccatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: