Login to display prices
Login to display prices
MTMR10-myotubularin related protein 10 Gene View larger

MTMR10-myotubularin related protein 10 Gene

PTXBC063296

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTMR10-myotubularin related protein 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTMR10-myotubularin related protein 10 Gene

Proteogenix catalog: PTXBC063296
Ncbi symbol: MTMR10
Product name: MTMR10-myotubularin related protein 10 Gene
Size: 2ug
Accessions: BC063296
Gene id: 54893
Gene description: myotubularin related protein 10
Synonyms: myotubularin-related protein 10; myotubularin related protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccattacagaaattccattacagaaaccttcttcttggtgaacacgatgtccctttaacatgtattgaacaaattgtcacagtaaacgaccacaagaggaagcagaaagtcctaggccccaaccagaaactgaaatttaatccaacagagttaattatttattgtaaagatttcagaattgtcagatttcgctttgatgaatcaggtcccgaaagtgctaaaaagcaaacaaaattaatggaattccctcaggagatggaggaggaggaggaggaggaggtaatggagctggtggtggcagcagccagaaaactccactctttgaaacttactcggattgggacagagaaatcaagaggacaggtgcttccgggtggagagtttgttctattaacgagggttacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: