MTMR10-myotubularin related protein 10 Gene View larger

MTMR10-myotubularin related protein 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTMR10-myotubularin related protein 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTMR10-myotubularin related protein 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063296
Product type: DNA & cDNA
Ncbi symbol: MTMR10
Origin species: Human
Product name: MTMR10-myotubularin related protein 10 Gene
Size: 2ug
Accessions: BC063296
Gene id: 54893
Gene description: myotubularin related protein 10
Synonyms: myotubularin-related protein 10; myotubularin related protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccattacagaaattccattacagaaaccttcttcttggtgaacacgatgtccctttaacatgtattgaacaaattgtcacagtaaacgaccacaagaggaagcagaaagtcctaggccccaaccagaaactgaaatttaatccaacagagttaattatttattgtaaagatttcagaattgtcagatttcgctttgatgaatcaggtcccgaaagtgctaaaaagcaaacaaaattaatggaattccctcaggagatggaggaggaggaggaggaggaggtaatggagctggtggtggcagcagccagaaaactccactctttgaaacttactcggattgggacagagaaatcaagaggacaggtgcttccgggtggagagtttgttctattaacgagggttacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2S
- lipoxygenase homology domains 1
- flavin containing monooxygenase 1
- RUN and FYVE domain containing 2

Buy MTMR10-myotubularin related protein 10 Gene now

Add to cart