Login to display prices
Login to display prices
LOC492303-FAM51A1 pseudogene Gene View larger

LOC492303-FAM51A1 pseudogene Gene

PTXBC009550

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC492303-FAM51A1 pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC492303-FAM51A1 pseudogene Gene

Proteogenix catalog: PTXBC009550
Ncbi symbol: LOC492303
Product name: LOC492303-FAM51A1 pseudogene Gene
Size: 2ug
Accessions: BC009550
Gene id: 492303
Gene description: FAM51A1 pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaccgagtcagatgcagaggtagcatgtgacctgagcaatatggaaatcaccgaagagctccgccagtactttgcagagacagagaggcacagagaagaactactgcggcggcaacagctggatgcggagcgcctgaacagctacgtgaacgctgaacacgacctgtactgcaacacccgccggtcggtagaggccccagctgagaggcctggtgagcggcgccaggccgaaatgaagcgtttgtactgggacagcgccgccaagatccaggccatggaggctaacgtgcagctgagctttgacaagcactgtgatccaaagcagcctaattactggccggtcatccccccgaagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: